National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14968R-3 
 Symbol CG14968  Full Name CG14968 
 CG No CG14968  Old CG No CG14968 
 Synonyms anon-WO0107627.3, anon-WO0107627.2, anon-WO0107627.1, CG14968 
 Accession No (Link to NCBI) NM_168011.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GATCTGGACAGCCAGGTCAATGTGGAGGATTTGCCCATAACGTTCAAGGTGAAGTACATT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGTTCCGAAGTGGCACGTGGCTTATGGGGCATTAAGTATACGCGTCGTCCGGTGGACATA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGGTGGGCGTGGCCAAGAACCTGCCGCCCAATAAGGTGCTGCCCAACTGCGAACTGAAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTGTCCACCGACGGAGTCCAGCTGGAGATCATATCGCCAAAGGCCAGCATCAATCACTGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCTATCCCATCGACACGATCTCGTATGGCGTTCAGGACCTGGTCTACACAAGGGTCTTT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCATGATCGTGGTGAAGGACGAGTCGAGTCCGCATCCCTTTGAGGTTCACGCCTTCGTG 360

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     361 TGCGACAGTCGTGCGATGGCGCGGAAGTTGACCTTTGCCCTGGCCGCCGCCTTCCAGGAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TACTCGCGACGGGTCAAGGAGGCAACCGGTGAGGAGGAGGGCGAGGCCACGCCCAGCGAC 480

14968R-3.IR_full       481 ACTATTACACCCACGCGACA 500
                           |||||||||||||||||||| silico     481 ACTATTACACCCACGCGACA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139543.2  CG14968-RB, transcript variant B (CG14968), mRNA 
100   482  NM_168012.1  CG14968-RC, transcript variant C (CG14968), mRNA 
100   482  NM_168014.1  CG14968-RE, transcript variant E (CG14968), mRNA 
100   482  NM_168013.1  CG14968-RD, transcript variant D (CG14968), mRNA 
100   482  NM_168011.1  CG14968-RA, transcript variant A (CG14968), mRNA 
0.41   NM_132173.2  CG12153-RA (Hira), mRNA 
0   NM_057664.4  CG15444-RB, transcript variant B (ine), mRNA 
0   NM_175959.1  CG15444-RD, transcript variant D (ine), mRNA 
0   NM_079230.2  CG32386-RA (corn), mRNA 
0   NM_057911.3  CG6382-RA (Elf), mRNA 
0   10  NM_167189.2  CG32705-RA (CG32705), mRNA 
0   NM_057431.2  CG7171-RA (Uro), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_168898.1  CG32436-RA (CG32436), mRNA 
0   NM_080327.2  CG3665-RA, transcript variant A (Fas2), mRNA 
0   NM_167004.1  CG3665-RB, transcript variant B (Fas2), mRNA 
0   NM_167005.1  CG3665-RC, transcript variant C (Fas2), mRNA 
0   NM_141262.2  CG12005-RB (Mms19), mRNA 
0   NM_130550.2  CG11417-RA (CG11417), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_135223.2  CG11199-RA, transcript variant A (Liprin-alpha), mRNA 
0   NM_164707.1  CG11199-RB, transcript variant B (Liprin-alpha), mRNA 
0   NM_142393.1  CG14321-RA (CG14321), mRNA 
0   NM_134677.1  CG13690-RA (CG13690), mRNA 
0   NM_164645.1  CG31915-RA (CG31915), mRNA 
0   NM_057986.3  CG3456-RA (Mct1), mRNA 
0   NM_169151.1  CG31286-RC, transcript variant C (CG31286), mRNA 
0   NM_169152.1  CG31286-RB, transcript variant B (CG31286), mRNA 
0   NM_141417.2  CG1315-RA (CG1315), mRNA 
0   NM_080026.2  CG10847-RB, transcript variant B (enc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.