National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14968R-1 
 Symbol CG14968  Full Name CG14968 
 CG No CG14968  Old CG No CG14968 
 Synonyms anon-WO0107627.3, anon-WO0107627.2, anon-WO0107627.1, CG14968 
 Accession No (Link to NCBI) NM_168011.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCTGGACAGCCAGGTCAAT 
 Primer Seq. 3'
aatctagaggtaccTGTCGCGTGGGTGTAATAGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATCTGGACA GCCAGGTCAA TGTGGAGGAT TTGCCCATAA CGTTCAAGGT GAAGTACATT 
0061 GGTTCCGAAG TGGCACGTGG CTTATGGGGC ATTAAGTATA CGCGTCGTCC GGTGGACATA 
0121 ATGGTGGGCG TGGCCAAGAA CCTGCCGCCC AATAAGGTGC TGCCCAACTG CGAACTGAAG 
0181 GTGTCCACCG ACGGAGTCCA GCTGGAGATC ATATCGCCAA AGGCCAGCAT CAATCACTGG 
0241 AGCTATCCCA TCGACACGAT CTCGTATGGC GTTCAGGACC TGGTCTACAC AAGGGTCTTT 
0301 GCCATGATCG TGGTGAAGGA CGAGTCGAGT CCGCATCCCT TTGAGGTTCA CGCCTTCGTG 
0361 TGCGACAGTC GTGCGATGGC GCGGAAATTG ACCTTTGCCC TGGcCGCCGC CTTCCAGGAT 
0421 TACTCGCGAC GGGTCAAGGA GGCAACCGGT GAGGAGGAGG GCGAGGcCAC GCCCAGCGAC 
0481 ACTATTACAC CCACGCGACA  
 in silico PCR Fragment
0001 GATCTGGACA GCCAGGTCAA TGTGGAGGAT TTGCCCATAA CGTTCAAGGT GAAGTACATT 
0061 GGTTCCGAAG TGGCACGTGG CTTATGGGGC ATTAAGTATA CGCGTCGTCC GGTGGACATA 
0121 ATGGTGGGCG TGGCCAAGAA CCTGCCGCCC AATAAGGTGC TGCCCAACTG CGAACTGAAG 
0181 GTGTCCACCG ACGGAGTCCA GCTGGAGATC ATATCGCCAA AGGCCAGCAT CAATCACTGG 
0241 AGCTATCCCA TCGACACGAT CTCGTATGGC GTTCAGGACC TGGTCTACAC AAGGGTCTTT 
0301 GCCATGATCG TGGTGAAGGA CGAGTCGAGT CCGCATCCCT TTGAGGTTCA CGCCTTCGTG 
0361 TGCGACAGTC GTGCGATGGC GCGGAAGTTG ACCTTTGCCC TGGCCGCCGC CTTCCAGGAT 
0421 TACTCGCGAC GGGTCAAGGA GGCAACCGGT GAGGAGGAGG GCGAGGCCAC GCCCAGCGAC 
0481 ACTATTACAC CCACGCGACA  
 Assemble Data

14968R-1.IR_full       1   GATCTGGACAGCCAGGTCAATGTGGAGGATTTGCCCATAACGTTCAAGGTGAAGTACATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14968R-1.in silico     1   GATCTGGACAGCCAGGTCAATGTGGAGGATTTGCCCATAACGTTCAAGGTGAAGTACATT 60


14968R-1.IR_full       61  GGTTCCGAAGTGGCACGTGGCTTATGGGGCATTAAGTATACGCGTCGTCCGGTGGACATA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14968R-1.in silico     61  GGTTCCGAAGTGGCACGTGGCTTATGGGGCATTAAGTATACGCGTCGTCCGGTGGACATA 120


14968R-1.IR_full       121 ATGGTGGGCGTGGCCAAGAACCTGCCGCCCAATAAGGTGCTGCCCAACTGCGAACTGAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14968R-1.in silico     121 ATGGTGGGCGTGGCCAAGAACCTGCCGCCCAATAAGGTGCTGCCCAACTGCGAACTGAAG 180


14968R-1.IR_full       181 GTGTCCACCGACGGAGTCCAGCTGGAGATCATATCGCCAAAGGCCAGCATCAATCACTGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14968R-1.in silico     181 GTGTCCACCGACGGAGTCCAGCTGGAGATCATATCGCCAAAGGCCAGCATCAATCACTGG 240


14968R-1.IR_full       241 AGCTATCCCATCGACACGATCTCGTATGGCGTTCAGGACCTGGTCTACACAAGGGTCTTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14968R-1.in silico     241 AGCTATCCCATCGACACGATCTCGTATGGCGTTCAGGACCTGGTCTACACAAGGGTCTTT 300


14968R-1.IR_full       301 GCCATGATCGTGGTGAAGGACGAGTCGAGTCCGCATCCCTTTGAGGTTCACGCCTTCGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14968R-1.in silico     301 GCCATGATCGTGGTGAAGGACGAGTCGAGTCCGCATCCCTTTGAGGTTCACGCCTTCGTG 360


14968R-1.IR_full       361 TGCGACAGTCGTGCGATGGCGCGGAAATTGACCTTTGCCCTGGCCGCCGCCTTCCAGGAT 420
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
14968R-1.in silico     361 TGCGACAGTCGTGCGATGGCGCGGAAGTTGACCTTTGCCCTGGCCGCCGCCTTCCAGGAT 420


14968R-1.IR_full       421 TACTCGCGACGGGTCAAGGAGGCAACCGGTGAGGAGGAGGGCGAGGCCACGCCCAGCGAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14968R-1.in silico     421 TACTCGCGACGGGTCAAGGAGGCAACCGGTGAGGAGGAGGGCGAGGCCACGCCCAGCGAC 480


14968R-1.IR_full       481 ACTATTACACCCACGCGACA 500
                           ||||||||||||||||||||
14968R-1.in silico     481 ACTATTACACCCACGCGACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139543.2  CG14968-RB, transcript variant B (CG14968), mRNA 
100   482  NM_168012.1  CG14968-RC, transcript variant C (CG14968), mRNA 
100   482  NM_168014.1  CG14968-RE, transcript variant E (CG14968), mRNA 
100   482  NM_168013.1  CG14968-RD, transcript variant D (CG14968), mRNA 
100   482  NM_168011.1  CG14968-RA, transcript variant A (CG14968), mRNA 
0.41   NM_132173.2  CG12153-RA (Hira), mRNA 
0   NM_057664.4  CG15444-RB, transcript variant B (ine), mRNA 
0   NM_175959.1  CG15444-RD, transcript variant D (ine), mRNA 
0   NM_079230.2  CG32386-RA (corn), mRNA 
0   NM_057911.3  CG6382-RA (Elf), mRNA 
0   10  NM_167189.2  CG32705-RA (CG32705), mRNA 
0   NM_057431.2  CG7171-RA (Uro), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_168898.1  CG32436-RA (CG32436), mRNA 
0   NM_080327.2  CG3665-RA, transcript variant A (Fas2), mRNA 
0   NM_167004.1  CG3665-RB, transcript variant B (Fas2), mRNA 
0   NM_167005.1  CG3665-RC, transcript variant C (Fas2), mRNA 
0   NM_141262.2  CG12005-RB (Mms19), mRNA 
0   NM_130550.2  CG11417-RA (CG11417), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_135223.2  CG11199-RA, transcript variant A (Liprin-alpha), mRNA 
0   NM_164707.1  CG11199-RB, transcript variant B (Liprin-alpha), mRNA 
0   NM_142393.1  CG14321-RA (CG14321), mRNA 
0   NM_134677.1  CG13690-RA (CG13690), mRNA 
0   NM_164645.1  CG31915-RA (CG31915), mRNA 
0   NM_057986.3  CG3456-RA (Mct1), mRNA 
0   NM_169151.1  CG31286-RC, transcript variant C (CG31286), mRNA 
0   NM_169152.1  CG31286-RB, transcript variant B (CG31286), mRNA 
0   NM_141417.2  CG1315-RA (CG1315), mRNA 
0   NM_080026.2  CG10847-RB, transcript variant B (enc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.