National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14960R-3 
 Symbol CG14960  Full Name CG14960 
 CG No CG14960  Old CG No CG14960 
 Synonyms CG14960 
 Accession No (Link to NCBI) NM_139540.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCTTTGCAGCCAAGATAAC 
 Primer Seq. 3'
aatctagaggtaccAGACCTTGAGCAGGAACAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCCTTTGCA GCCAAGATAA CGAAGAAGGT CGAAAAAACG TCGGAAAAGC CAGAgGTGGA 
0061 GGCTGCTGCA TCNCCAATCG AGGAGGAAAA TGACGATGAA GATGCTGGCG AGGATGGTGA 
0121 TGACGACGAC GACGACGAGG AGGAAGAGGC GGGGGAACCT GCGGTGGATG CGGCTGACAA 
0181 AGAAGCTGCA GCAGGGGCAT CGAGTAACAA GAACCCCAAT GCAGTGCAGG CAGCCACGGA 
0241 TCCCACAGAT CTCAGTGTCT GGGGCATGGT TCGCACTCTG TGGGGCTGGC TTCGTAGCGA 
0301 TCTGAGTGAA AGCCTATTCG GCGATGACGA CGACGGGANA GCCCGCGTCC GGCAGCTCGG 
0361 CTGTGGAGGG TCGTACCTTT GGCAAAATCC GCCGTCTTCA AATGGCTTTG ATACCCATTA 
0421 TCTTTAAGTT TGGCGTCCTT TCGGCTATGG TTGCCTTTCT GGTCGCCATT GGTATGAAGT 
0481 CTCTGTTCCT GCTCAAGGTC T 
 in silico PCR Fragment
0001 TGCCTTTGCA GCCAAGATAA CGAAGAAGGT CGAAAAAACG TCGGAAAAGC CAGAGGTGGA 
0061 GGCTGCTGCA TCGCCAATCG AGGAGGAAAA TGACGATGAA GATGCTGGCG AGGATGGTGA 
0121 TGACGACGAC GACGACGAGG AGGAGGAGAC GGGGGAACCT GCGGTGGATG CGGCTGACAA 
0181 AGAAGCTGCA GTAGGGGCAT CGAGTAACAA GAACCCCAAT GCAGTGCAGG CAGCCACGGA 
0241 TCCCACAGAT CTCAGTGTCT GGGGCATGGT TCGCACTCTG TGGGGCTGGC TTCGTAGCGA 
0301 TCTGAGTGAA AGCCTATTCG GCGATGACGA CGACGGGA-A GCCCGCGTCC GGCAGCTCAG 
0361 CTGTGGAGGG TCGTACCTTT GGCAAAATCC GCCGTCTTCA AATGGCTTTG ATACCCATTA 
0421 TCTTTAAGTT TGGCGTCCTT TCGGCTATGG TTGCCTTTCT GGTCGCCATT GGTATGAAGT 
0481 CTCTGTTCCT GCTCAAGGTC T 
 Assemble Data

14960R-3.IR_full       1   TGCCTTTGCAGCCAAGATAACGAAGAAGGTCGAAAAAACGTCGGAAAAGCCAGAGGTGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14960R-3.in silico     1   TGCCTTTGCAGCCAAGATAACGAAGAAGGTCGAAAAAACGTCGGAAAAGCCAGAGGTGGA 60


14960R-3.IR_full       61  GGCTGCTGCATCNCCAATCGAGGAGGAAAATGACGATGAAGATGCTGGCGAGGATGGTGA 120
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
14960R-3.in silico     61  GGCTGCTGCATCGCCAATCGAGGAGGAAAATGACGATGAAGATGCTGGCGAGGATGGTGA 120


14960R-3.IR_full       121 TGACGACGACGACGACGAGGAGGAAGAGGCGGGGGAACCTGCGGTGGATGCGGCTGACAA 180
                           |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||
14960R-3.in silico     121 TGACGACGACGACGACGAGGAGGAGGAGACGGGGGAACCTGCGGTGGATGCGGCTGACAA 180


14960R-3.IR_full       181 AGAAGCTGCAGCAGGGGCATCGAGTAACAAGAACCCCAATGCAGTGCAGGCAGCCACGGA 240
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
14960R-3.in silico     181 AGAAGCTGCAGTAGGGGCATCGAGTAACAAGAACCCCAATGCAGTGCAGGCAGCCACGGA 240


14960R-3.IR_full       241 TCCCACAGATCTCAGTGTCTGGGGCATGGTTCGCACTCTGTGGGGCTGGCTTCGTAGCGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14960R-3.in silico     241 TCCCACAGATCTCAGTGTCTGGGGCATGGTTCGCACTCTGTGGGGCTGGCTTCGTAGCGA 300


14960R-3.IR_full       301 TCTGAGTGAAAGCCTATTCGGCGATGACGACGACGGGANAGCCCGCGTCCGGCAGCTCGG 360
                           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
14960R-3.in silico     301 TCTGAGTGAAAGCCTATTCGGCGATGACGACGACGGGA-AGCCCGCGTCCGGCAGCTCAG 360


14960R-3.IR_full       361 CTGTGGAGGGTCGTACCTTTGGCAAAATCCGCCGTCTTCAAATGGCTTTGATACCCATTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14960R-3.in silico     361 CTGTGGAGGGTCGTACCTTTGGCAAAATCCGCCGTCTTCAAATGGCTTTGATACCCATTA 420


14960R-3.IR_full       421 TCTTTAAGTTTGGCGTCCTTTCGGCTATGGTTGCCTTTCTGGTCGCCATTGGTATGAAGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14960R-3.in silico     421 TCTTTAAGTTTGGCGTCCTTTCGGCTATGGTTGCCTTTCTGGTCGCCATTGGTATGAAGT 480


14960R-3.IR_full       481 CTCTGTTCCTGCTCAAGGTCT 501
                           |||||||||||||||||||||
14960R-3.in silico     481 CTCTGTTCCTGCTCAAGGTCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  22  22  NM_139540.1  CG14960-RA (CG14960), mRNA 
1.86   35  36  55  NM_131987.2  CG4202-RA (Sas10), mRNA 
1.86   13  24  38  NM_132429.2  CG2202-RA (CG2202), mRNA 
1.45   16  14  22  NM_141549.1  CG8007-RB, transcript variant B (CG8007), mRNA 
1.45   21  24  NM_078524.2  CG2262-RA (Smox), mRNA 
1.24   14  18  49  NM_167309.1  CG32663-RA (CG32663), mRNA 
1.03   18  24  55  NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
1.03   18  24  55  NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
1.03   18  24  55  NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
1.03   18  23  44  NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0.82   10  10  36  NM_141571.2  CG8223-RA (CG8223), mRNA 
0.82   10  12  NM_079007.2  CG17716-RA (fas), mRNA 
0.62   10  20  17  NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 
0.62   37  58  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0.62   17  27  NM_143338.2  CG12259-RA (CG12259), mRNA 
0.41   13  20  28  NM_141852.1  CG12594-RA (CG12594), mRNA 
0.41   12  16  41  NM_206437.1  CG17603-RC, transcript variant C (Taf1), mRNA 
0.41   12  16  41  NM_057608.4  CG17603-RA, transcript variant A (Taf1), mRNA 
0.41   12  16  41  NM_206438.1  CG17603-RB, transcript variant B (Taf1), mRNA 
0.41   30  52  NM_144335.1  CG15476-RA (CG15476), mRNA 
0.41   18  21  NM_164853.1  CG3747-RB, transcript variant B (Eaat1), mRNA 
0.41   18  21  NM_058080.2  CG3747-RA, transcript variant A (Eaat1), mRNA 
0.41   18  21  NM_164854.1  CG3747-RC, transcript variant C (Eaat1), mRNA 
0.41   11  NM_132480.1  CG11756-RA (CG11756), mRNA 
0.41   24  46  NM_141129.1  CG11523-RA (CG11523), mRNA 
0.41   16  NM_137927.1  CG9871-RA (CG9871), mRNA 
0.2   40  78  NM_058131.3  CG6712-RA (CG6712), mRNA 
0.2   20  26  NM_143372.1  CG9995-RA (htt), mRNA 
0.2   15  43  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0.2   29  26  NM_130554.2  CG11448-RA (CG11448), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.