National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1494R-3 
 Symbol CG1494  Full Name CG1494 
 CG No CG1494  Old CG No CG1494 
 Synonyms CG1494 
 Accession No (Link to NCBI) NM_134600.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTGGCTGCCTTTTTCCGGAACGCTCTCAACGCCGTTCGGGTGTTGACAATCCTGTGGATA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGTCCTACGTGCCCACCTTCATTCTGTCGAACAACTTGGAGGGCAATATTCACGCCCTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCTACGTGTCGTATGCGCTGCCAAATGTGGTGGCAACTCTGGTGATTGAATTTCTCATC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAACGGGAGTCGATCGTCCATATCACGTGGGAGGACTCTGGGTACAGACTCAACTATGAC 240

                          ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     241 GGCGGCCACATAACGGT-AACCGCGAGCTCCTGGATCTTCATGCTGAATGCTTTGGTTTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGTGCAATTGGTCTCTATGTGGACATGTGGCGGGGTGGCGACCGATCGGGTAAGAAGAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAGAAACCCAACACGAATGCCAGTGTACAAGAAGATCCATACCACGAACGGGGGGACAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTTCACTCATCAGGGTCAGGCCATTGGCGTTAACTCAACGAAAATCTATGAGGTGGAACC 480

1494R-3.IR_full       481 CTCACATCGGCGCTTCAAGCT 501
                          ||||||||||||||||||||| silico     481 CTCACATCGGCGCTTCAAGCT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134600.1  CG1494-RA (CG1494), mRNA 
0   NM_132467.2  CG1386-RA (antdh), mRNA 
0   NM_057999.4  CG4602-RA (Srp54), mRNA 
0   NM_138143.1  CG12851-RA (CG12851), mRNA 
0   NM_168352.1  CG32048-RA, transcript variant A (CG32048), mRNA 
0   NM_168353.1  CG32048-RB, transcript variant B (CG32048), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_139776.2  CG10289-RA (CG10289), mRNA 
0   NM_142891.1  CG17382-RA (CG17382), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_136212.1  CG9323-RA (CG9323), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_143410.2  CG11874-RA (CG11874), mRNA 
0   11  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   11  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NR_002008.1  CG8571-RB, transcript variant B (smid), mRNA, mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_001015383.1  CG12567-PB.3 (CG12567), mRNA 
0   NM_001015384.1  CG12567-PA.3 (CG12567), mRNA 
0   NM_144383.1  CG17799-RA (lectin-29Ca), mRNA 
0   NM_137819.2  CG11206-RA, transcript variant A (CG11206), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.