National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1494R-2 
 Symbol CG1494  Full Name CG1494 
 CG No CG1494  Old CG No CG1494 
 Synonyms CG1494 
 Accession No (Link to NCBI) NM_134600.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGCTGCCTTTTTCCGGAAC 
 Primer Seq. 3'
aatctagaggtaccAGCTTGAAGCGCCGATGTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGGCTGCCT TTTTCCGGAA CGCTCTCAAC GCCGTTCGGG TGTTGACAAT CCTGTGGATA 
0061 ATGTCCTACG TGCCCACCTT CATTCTGTCG AACAACTTGG AGGGCAATAT TCACGCCCTG 
0121 CGCTACGTGT CGTATGCGCT GCCAAATGTG GTGGCAACTC TGGTGATTGA ATTTCTCATC 
0181 GAACGGGAGT CGATCGTCCA TATCACGTGG GAGGACTCTG GGTACAGACT CAACTATGAC 
0241 GGCGGCCACA TAACGGTAAA CCGCGAGCTC CTGGATCTTC ATGCTGAATG CTTTGGTTTA 
0301 CTGTGCAATT GGTCTCTATG TGGACATGTG GCGGGGTGGC GACCGATCGG GTAAGAAGAT 
0361 GAAGAAACCC AACACGAATG CCAGTGTACA AGAAGATCCA TACCACGAAC GGGGGGACAG 
0421 TTTCACTCAT CAGGGTCAGG CCATTGGCGT TAACTCAACG AAAATCTATG AGGTGGAACC 
0481 CTCACATCGG CGCTTCAAGC T 
 in silico PCR Fragment
0001 GTGGCTGCCT TTTTCCGGAA CGCTCTCAAC GCCGTTCGGG TGTTGACAAT CCTGTGGATA 
0061 ATGTCCTACG TGCCCACCTT CATTCTGTCG AACAACTTGG AGGGCAATAT TCACGCCCTG 
0121 CGCTACGTGT CGTATGCGCT GCCAAATGTG GTGGCAACTC TGGTGATTGA ATTTCTCATC 
0181 GAACGGGAGT CGATCGTCCA TATCACGTGG GAGGACTCTG GGTACAGACT CAACTATGAC 
0241 GGCGGCCACA TAACGGT-AA CCGCGAGCTC CTGGATCTTC ATGCTGAATG CTTTGGTTTA 
0301 CTGTGCAATT GGTCTCTATG TGGACATGTG GCGGGGTGGC GACCGATCGG GTAAGAAGAT 
0361 GAAGAAACCC AACACGAATG CCAGTGTACA AGAAGATCCA TACCACGAAC GGGGGGACAG 
0421 TTTCACTCAT CAGGGTCAGG CCATTGGCGT TAACTCAACG AAAATCTATG AGGTGGAACC 
0481 CTCACATCGG CGCTTCAAGC T 
 Assemble Data

1494R-2.IR_full       1   GTGGCTGCCTTTTTCCGGAACGCTCTCAACGCCGTTCGGGTGTTGACAATCCTGTGGATA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     1   GTGGCTGCCTTTTTCCGGAACGCTCTCAACGCCGTTCGGGTGTTGACAATCCTGTGGATA 60


1494R-2.IR_full       61  ATGTCCTACGTGCCCACCTTCATTCTGTCGAACAACTTGGAGGGCAATATTCACGCCCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     61  ATGTCCTACGTGCCCACCTTCATTCTGTCGAACAACTTGGAGGGCAATATTCACGCCCTG 120


1494R-2.IR_full       121 CGCTACGTGTCGTATGCGCTGCCAAATGTGGTGGCAACTCTGGTGATTGAATTTCTCATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     121 CGCTACGTGTCGTATGCGCTGCCAAATGTGGTGGCAACTCTGGTGATTGAATTTCTCATC 180


1494R-2.IR_full       181 GAACGGGAGTCGATCGTCCATATCACGTGGGAGGACTCTGGGTACAGACTCAACTATGAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     181 GAACGGGAGTCGATCGTCCATATCACGTGGGAGGACTCTGGGTACAGACTCAACTATGAC 240


1494R-2.IR_full       241 GGCGGCCACATAACGGTAAACCGCGAGCTCCTGGATCTTCATGCTGAATGCTTTGGTTTA 300
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     241 GGCGGCCACATAACGGT-AACCGCGAGCTCCTGGATCTTCATGCTGAATGCTTTGGTTTA 300


1494R-2.IR_full       301 CTGTGCAATTGGTCTCTATGTGGACATGTGGCGGGGTGGCGACCGATCGGGTAAGAAGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     301 CTGTGCAATTGGTCTCTATGTGGACATGTGGCGGGGTGGCGACCGATCGGGTAAGAAGAT 360


1494R-2.IR_full       361 GAAGAAACCCAACACGAATGCCAGTGTACAAGAAGATCCATACCACGAACGGGGGGACAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     361 GAAGAAACCCAACACGAATGCCAGTGTACAAGAAGATCCATACCACGAACGGGGGGACAG 420


1494R-2.IR_full       421 TTTCACTCATCAGGGTCAGGCCATTGGCGTTAACTCAACGAAAATCTATGAGGTGGAACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1494R-2.in silico     421 TTTCACTCATCAGGGTCAGGCCATTGGCGTTAACTCAACGAAAATCTATGAGGTGGAACC 480


1494R-2.IR_full       481 CTCACATCGGCGCTTCAAGCT 501
                          |||||||||||||||||||||
1494R-2.in silico     481 CTCACATCGGCGCTTCAAGCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134600.1  CG1494-RA (CG1494), mRNA 
0   NM_132467.2  CG1386-RA (antdh), mRNA 
0   NM_057999.4  CG4602-RA (Srp54), mRNA 
0   NM_138143.1  CG12851-RA (CG12851), mRNA 
0   NM_168352.1  CG32048-RA, transcript variant A (CG32048), mRNA 
0   NM_168353.1  CG32048-RB, transcript variant B (CG32048), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_139776.2  CG10289-RA (CG10289), mRNA 
0   NM_142891.1  CG17382-RA (CG17382), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_136212.1  CG9323-RA (CG9323), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_143410.2  CG11874-RA (CG11874), mRNA 
0   11  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   11  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NR_002008.1  CG8571-RB, transcript variant B (smid), mRNA, mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_001015383.1  CG12567-PB.3 (CG12567), mRNA 
0   NM_001015384.1  CG12567-PA.3 (CG12567), mRNA 
0   NM_144383.1  CG17799-RA (lectin-29Ca), mRNA 
0   NM_137819.2  CG11206-RA, transcript variant A (CG11206), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.