National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14934R-1 
 Symbol CG14934  Full Name CG14934 
 CG No CG14934  Old CG No CG14934 
 Synonyms CG14934 
 Accession No (Link to NCBI) NM_135678.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCTAGTAGGCATATTGGCCC 
 Primer Seq. 3'
aatctagaggtaccGGATCCGGAGAACACCGACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCTANGTAG GCATATTGGC CCATAAGCAC CAGTCAAAGG AGCTGGATGC GAAATATAAT 
0061 TGGTGGCAGC ACGAGGTCTT CTATCAGATC TATCCGAGAT CCTTTCAGGA CAGCAATGGT 
0121 GATGGTATTG GTGATCTTCA AGGTATTACT TCTAGGCTAC AGTACTTCAA GGATACGGGC 
0181 ATCACGTCCG TATGGTTGAG TCCCATTTAT GAGTCACCAA TGGTAGACTT TGGATACGAT 
0241 ATATCTAACT ATACAAATAT ACAGCCGGAA TATGGCACCC TTGAGGACTT TGACGCCTTG 
0301 ATAGCCAAGG CCAATGAACT GGGCGTGAAA GTTATTTTGG ACTTTGTTCC CAATCACAGC 
0361 TCAAATAAGC ATCCCTGGTT CATAAAGTCA GTAGCCCGAG AGCCAGGGTA CGAGGATTTC 
0421 TATGTGTGGG AGGATGGTAT TCTCCTGGAG AACGGAACTC GTGTGCCGCC CAACAATTGG 
0481 CTGTCGGTGT TCTNCCGGAT Nc 
 in silico PCR Fragment
0001 GCCTA-GTAG GCATATTGGC CCATAAGCAC CAGTCAAAGG AGCTGGATGC GAAATATAAT 
0061 TGGTGGCAGC ACGAGGTCTT CTATCAGATC TATCCGAGAT CCTTTCAGGA CAGCAATGGT 
0121 GATGGTATTG GTGATCTTCA AGGTATTACT TCTAGGCTAC AGTACTTCAA GGATACGGGC 
0181 ATCACGTCCG TATGGTTGAG TCCCATTTAT GAGTCACCAA TGGTAGACTT TGGATACGAT 
0241 ATATCTAACT ATACAAATAT ACAGCCGGAA TATGGCACCC TTGAGGACTT TGACGCCTTG 
0301 ATAGCCAAGG CCAATGAACT GGGCGTGAAA GTTATTTTGG ACTTTGTTCC CAATCACAGC 
0361 TCAAATAAGC ATCCCTGGTT CATAAAGTCA GTAGCCCGAG AGCCAGGGTA CGAGGATTTC 
0421 TATGTGTGGG AGGATGGTAT TCTCCTGGAG AACGGAACTC GTGTGCCGCC CAACAATTGG 
0481 CTGTCGGTGT TCT-CCGGAT CC 
 Assemble Data

14934R-1.IR_full       1   GCCTANGTAGGCATATTGGCCCATAAGCACCAGTCAAAGGAGCTGGATGCGAAATATAAT 60
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     1   GCCTA-GTAGGCATATTGGCCCATAAGCACCAGTCAAAGGAGCTGGATGCGAAATATAAT 60


14934R-1.IR_full       61  TGGTGGCAGCACGAGGTCTTCTATCAGATCTATCCGAGATCCTTTCAGGACAGCAATGGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     61  TGGTGGCAGCACGAGGTCTTCTATCAGATCTATCCGAGATCCTTTCAGGACAGCAATGGT 120


14934R-1.IR_full       121 GATGGTATTGGTGATCTTCAAGGTATTACTTCTAGGCTACAGTACTTCAAGGATACGGGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     121 GATGGTATTGGTGATCTTCAAGGTATTACTTCTAGGCTACAGTACTTCAAGGATACGGGC 180


14934R-1.IR_full       181 ATCACGTCCGTATGGTTGAGTCCCATTTATGAGTCACCAATGGTAGACTTTGGATACGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     181 ATCACGTCCGTATGGTTGAGTCCCATTTATGAGTCACCAATGGTAGACTTTGGATACGAT 240


14934R-1.IR_full       241 ATATCTAACTATACAAATATACAGCCGGAATATGGCACCCTTGAGGACTTTGACGCCTTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     241 ATATCTAACTATACAAATATACAGCCGGAATATGGCACCCTTGAGGACTTTGACGCCTTG 300


14934R-1.IR_full       301 ATAGCCAAGGCCAATGAACTGGGCGTGAAAGTTATTTTGGACTTTGTTCCCAATCACAGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     301 ATAGCCAAGGCCAATGAACTGGGCGTGAAAGTTATTTTGGACTTTGTTCCCAATCACAGC 360


14934R-1.IR_full       361 TCAAATAAGCATCCCTGGTTCATAAAGTCAGTAGCCCGAGAGCCAGGGTACGAGGATTTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     361 TCAAATAAGCATCCCTGGTTCATAAAGTCAGTAGCCCGAGAGCCAGGGTACGAGGATTTC 420


14934R-1.IR_full       421 TATGTGTGGGAGGATGGTATTCTCCTGGAGAACGGAACTCGTGTGCCGCCCAACAATTGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14934R-1.in silico     421 TATGTGTGGGAGGATGGTATTCTCCTGGAGAACGGAACTCGTGTGCCGCCCAACAATTGG 480


14934R-1.IR_full       481 CTGTCGGTGTTCTNCCGGATNC 502
                           ||||||||||||| |||||| |
14934R-1.in silico     481 CTGTCGGTGTTCT-CCGGATCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135678.1  CG14934-RA (CG14934), mRNA 
0.62   11  48  70  NM_164975.2  CG14935-RB, transcript variant B (CG14935), mRNA 
0.62   11  48  70  NM_135679.3  CG14935-RA, transcript variant A (CG14935), mRNA 
0.2   NM_057392.3  CG3325-RA (spn-B), mRNA 
0.2   NM_001038841.1  CG8669-RD, transcript variant D (crc), mRNA 
0   NM_142393.1  CG14321-RA (CG14321), mRNA 
0   NM_078713.2  CG17596-RA (S6kII), mRNA 
0   12  42  NM_136539.1  CG11669-RA (CG11669), mRNA 
0   NM_165220.1  CG6605-RA (BicD), mRNA 
0   NM_140498.1  CG7003-RA (CG7003), mRNA 
0   NM_140043.3  CG4347-RA, transcript variant A (UGP), mRNA 
0   NM_168325.2  CG4347-RC, transcript variant C (UGP), mRNA 
0   18  16  NM_136538.2  CG30359-RA (CG30359), mRNA 
0   NR_001369.1  CG30359-RA (CG30359), mRNA, mRNA 
0   NM_141932.2  CG11466-RA, transcript variant A (Cyp9f2), mRNA 
0   NM_206478.1  CG11466-RB, transcript variant B (Cyp9f2), mRNA 
0   NM_143313.1  CG5639-RA (CG5639), mRNA 
0   NM_137572.2  CG10062-RA (CG10062), mRNA 
0   NM_143167.2  CG17198-RA (CG17198), mRNA 
0   20  19  NM_057280.3  CG8695-RA (LvpL), mRNA 
0   13  23  NM_165608.1  CG30360-RA, transcript variant A (CG30360), mRNA 
0   13  23  NM_206057.1  CG30360-RB, transcript variant B (CG30360), mRNA 
0   35  NM_057277.2  CG8694-RA (LvpD), mRNA 
0   32  NM_057279.4  CG8696-RA (LvpH), mRNA 
0   25  NM_136540.1  CG8690-RA (CG8690), mRNA 
0   NM_142330.1  CG5225-RA (CG5225), mRNA 
0   NM_140919.1  CG7385-RA (CG7385), mRNA 
0   NM_144248.1  CG14773-RA (CG14773), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.