National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14932R-3 
 Symbol CG14932  Full Name CG14932 
 CG No CG14932  Old CG No CG14932 
 Synonyms CG14932 
 Accession No (Link to NCBI) NM_135673.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGGCAGACTGGTCCCCATA 
 Primer Seq. 3'
aatctagaggtaccCGGCGCATCCTCTTGGATTTC 
 Predicted Fragment Size
495 
 IR fragment full Seq
0001 TGGGGCAGAC TGGTcCCCAT ATGTCACTTA TGAGGCGGGT ACACCAAGAC GTCCCCCACA 
0061 GTGCTTTGGA GATTACCGAA ATTACCGAGT TTCCGAAAAT TCCAAAGAAA AACCCCACCT 
0121 CACCCGAACT GGTGATACAG AAGCCAGAGA CTCCGGATCA AAACGACTCG GGATCTCAGG 
0181 AGCGTCTCAC CTTCTNCTCG CGCCAATAAT GCGCTATCAG AGTCCATTGG AGCTCGCGTT 
0241 TCCCAACGTA GCAGGGGCAA CTTGGAACCA TTCATCCGTA GAATGGCACG TAGCCCTACG 
0301 CCCGAGGCCT CAGAGGAAAA CGGCTCGGTA TCACAAGGTC AGCTGCTGGC CAAGCCCGTG 
0361 GATGTCACCG AGTTCTTTCA NCCGCATTGC TGTGGGTCTC GTCGAGCAGC GCGTCTGCTT 
0421 GAAGCCTTTC TTGGCATTGC GCAAACATAT TGCTCAACTG GTGGGTCAGA CTTTGAAGAA 
0481 ATCCAAGAGG ATGCGCCG 
 in silico PCR Fragment
0001 TGGGGCAGAC TGGTCCCCAT ATGTCACTTA TGAGGCGGGT ACACCAAGAC GT-CCCCACA 
0061 GTGCTTTGGA GATTACCGAA ATTACCGAGT TTCCGAAAAT TCCAAAGAAA AACCCCACCT 
0121 CACCCGAACT GGTGATACAG AAGCCAGAGA CTCCGGATCA AAACGACTCG GGATCTCAGG 
0181 AGCGTCTCAC CTTCT-CTCG CGCCAATAAT GCGCTATCAG AGTCCATTGG AGCTCGCGTT 
0241 TCCCAACGTA GCAGGGGCAA CTTGGAACCA TTCATCCGTA GAATGGCACG TAGCCCTACG 
0301 CCCGAGGCCT CAGAGGAAAA CGGCTCGGTA TCACAAGGTC AGCTGCTGGC CAAGCCCGTG 
0361 GATGTCACCG AGTTCTTTCA -CCGCATTGC TGTGGGTCTC GTCGAGCAGC GCGTCTGCTT 
0421 GAAGCCTTTC TTGGCATTGC GCAAACATAT TGCTCAACTG GTGGGTCAGA CTTTGAAGAA 
0481 ATCCAAGAGG ATGCGCCG 
 Assemble Data

14932R-3.IR_full       1   TGGGGCAGACTGGTCCCCATATGTCACTTATGAGGCGGGTACACCAAGACGTCCCCCACA 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
14932R-3.in silico     1   TGGGGCAGACTGGTCCCCATATGTCACTTATGAGGCGGGTACACCAAGACGT-CCCCACA 60


14932R-3.IR_full       61  GTGCTTTGGAGATTACCGAAATTACCGAGTTTCCGAAAATTCCAAAGAAAAACCCCACCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14932R-3.in silico     61  GTGCTTTGGAGATTACCGAAATTACCGAGTTTCCGAAAATTCCAAAGAAAAACCCCACCT 120


14932R-3.IR_full       121 CACCCGAACTGGTGATACAGAAGCCAGAGACTCCGGATCAAAACGACTCGGGATCTCAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14932R-3.in silico     121 CACCCGAACTGGTGATACAGAAGCCAGAGACTCCGGATCAAAACGACTCGGGATCTCAGG 180


14932R-3.IR_full       181 AGCGTCTCACCTTCTNCTCGCGCCAATAATGCGCTATCAGAGTCCATTGGAGCTCGCGTT 240
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
14932R-3.in silico     181 AGCGTCTCACCTTCT-CTCGCGCCAATAATGCGCTATCAGAGTCCATTGGAGCTCGCGTT 240


14932R-3.IR_full       241 TCCCAACGTAGCAGGGGCAACTTGGAACCATTCATCCGTAGAATGGCACGTAGCCCTACG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14932R-3.in silico     241 TCCCAACGTAGCAGGGGCAACTTGGAACCATTCATCCGTAGAATGGCACGTAGCCCTACG 300


14932R-3.IR_full       301 CCCGAGGCCTCAGAGGAAAACGGCTCGGTATCACAAGGTCAGCTGCTGGCCAAGCCCGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14932R-3.in silico     301 CCCGAGGCCTCAGAGGAAAACGGCTCGGTATCACAAGGTCAGCTGCTGGCCAAGCCCGTG 360


14932R-3.IR_full       361 GATGTCACCGAGTTCTTTCANCCGCATTGCTGTGGGTCTCGTCGAGCAGCGCGTCTGCTT 420
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
14932R-3.in silico     361 GATGTCACCGAGTTCTTTCA-CCGCATTGCTGTGGGTCTCGTCGAGCAGCGCGTCTGCTT 420


14932R-3.IR_full       421 GAAGCCTTTCTTGGCATTGCGCAAACATATTGCTCAACTGGTGGGTCAGACTTTGAAGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14932R-3.in silico     421 GAAGCCTTTCTTGGCATTGCGCAAACATATTGCTCAACTGGTGGGTCAGACTTTGAAGAA 480


14932R-3.IR_full       481 ATCCAAGAGGATGCGCCG 498
                           ||||||||||||||||||
14932R-3.in silico     481 ATCCAAGAGGATGCGCCG 498

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   477  NM_135673.1  CG14932-RA (CG14932), mRNA 
0.2   NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_080146.2  CG10772-RB, transcript variant B (Fur1), mRNA 
0   NM_133159.1  CG14200-RA (CG14200), mRNA 
0   NM_137879.2  CG9825-RA (CG9825), mRNA 
0   NM_140985.2  CG4825-RA (CG4825), mRNA 
0   NM_141005.1  CG3618-RA (CG3618), mRNA 
0   NM_143138.1  CG5127-RA (CG5127), mRNA 
0   NM_143730.2  CG8186-RA (Vha36), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_137100.2  CG8503-RA (CG8503), mRNA 
0   NM_138254.2  CG9153-RB, transcript variant B (CG9153), mRNA 
0   NM_167868.1  CG9153-RA, transcript variant A (CG9153), mRNA 
0   NM_136055.2  CG10376-RA (CG10376), mRNA 
0   NM_138192.1  CG13891-RA (CG13891), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_135604.2  CG12299-RA (CG12299), mRNA 
0   NM_141040.1  CG7752-RA (Z4), mRNA 
0   NM_057245.2  CG6189-RA (l(1)1Bi), mRNA 
0   NM_135023.1  CG11927-RA (CG11927), mRNA 
0   NM_136130.3  CG18094-RA (CG18094), mRNA 
0   NM_135800.2  CG6565-RA (CG6565), mRNA 
0   NM_001042936.1  CG40006-RA (CG40006), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_206195.1  CG33226-RA (CG33226), mRNA 
0   NM_079839.2  CG7929-RA (ocn), mRNA 
0   NM_139472.2  CG16984-RA (CG16984), mRNA 
0   NM_079861.2  CG1455-RA (CanA1), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.