National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14930R-1 
 Symbol CG14930  Full Name CG14930 
 CG No CG14930  Old CG No CG14930 
 Synonyms CG14930 
 Accession No (Link to NCBI) NM_135664.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCGAGCGCGACTTAGACATC 
 Primer Seq. 3'
aatctagaggtaccGCCTTAAGACCCGGGCTTGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCGAGCGCG ACTTAGACAT CCGCTCTGAT CTGGAGTTCG TAGATGGTAT GCTGAAGGAC 
0061 CTGCAATTGG AGGTGGAGCC GCAGGCTCGT GGGGTCATCT TGGATCTGGC TTATACTTTG 
0121 GCAAGGGACA AACTCGTCGA GGCTCAACGT TTCGCAAAGT TGGTCAATCG CACCAAAGTG 
0181 AGTATCGAGG ACTTGAAGAT GGCCAACCTG GAGCGGACAG AGGAGCTGAG CAAGAGAGCG 
0241 ATCCATACGC CGGTGAAGTC CCTTATTCCC AGCCAGGCAT CTCTGCCCTC GCCGACTGTG 
0301 AGCCGTGGAC TGATGCTGCC CACCTGGCGG CAGTGTCAGA TGGGTACAAT GGCCGAATTG 
0361 AAGGACAAGG TCCCTGAGAC TCAGCCACCG AATCCCAAGC CCGTGCCACC CCTAACACCG 
0421 GTAACAGCTT CTACTCCTGG TCTAAACTCT GGCTCCAATT CGATGCTGAC TACTGGATCT 
0481 TCAAGCCCGG GTCTTAAGGC  
 in silico PCR Fragment
0001 AGCGAGCGCG ACTTAGACAT CCGCTCTGAT CTGGAGTTCG TAGATGGTAT GCTGAAGGAC 
0061 CTGCAATTGG AGGTGGAGCC GCAGGCTCGT GGGGTCATCT TGGATCTGGC TTATACTTTG 
0121 GCAAGGGACA AACTCGTCGA GGCTCAACGT TTCGCAAAGT TGGTCAATCG CACCAAAGTG 
0181 AGTATCGAGG ACTTGAAGAT GGCCAACCTG GAGCGGACAG AGGAGCTGAG CAAGAGAGCG 
0241 ATCCATACGC CGGTGAAGTC CCTTATTCCC AGCCAGGCAT CTCTGCCCTC GCCGACTGTG 
0301 AGCCGTGGAC TGATGCTGCC CACCTGGCGG CAGTGTCAGA TGGGTACAAT GGCCGAATTG 
0361 AAGGACAAGG TCCCTGAGAC TCAGCCACCG AATCCCAAGC CCGTGCCACC CCTAACACCG 
0421 GTAACAGCTT CTACTCCTGG TCTAAACTCT GGCTCCAATT CGATGCTGAC TACTGGATCT 
0481 TCAAGCCCGG GTCTTAAGGC  
 Assemble Data

14930R-1.IR_full       1   AGCGAGCGCGACTTAGACATCCGCTCTGATCTGGAGTTCGTAGATGGTATGCTGAAGGAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     1   AGCGAGCGCGACTTAGACATCCGCTCTGATCTGGAGTTCGTAGATGGTATGCTGAAGGAC 60


14930R-1.IR_full       61  CTGCAATTGGAGGTGGAGCCGCAGGCTCGTGGGGTCATCTTGGATCTGGCTTATACTTTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     61  CTGCAATTGGAGGTGGAGCCGCAGGCTCGTGGGGTCATCTTGGATCTGGCTTATACTTTG 120


14930R-1.IR_full       121 GCAAGGGACAAACTCGTCGAGGCTCAACGTTTCGCAAAGTTGGTCAATCGCACCAAAGTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     121 GCAAGGGACAAACTCGTCGAGGCTCAACGTTTCGCAAAGTTGGTCAATCGCACCAAAGTG 180


14930R-1.IR_full       181 AGTATCGAGGACTTGAAGATGGCCAACCTGGAGCGGACAGAGGAGCTGAGCAAGAGAGCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     181 AGTATCGAGGACTTGAAGATGGCCAACCTGGAGCGGACAGAGGAGCTGAGCAAGAGAGCG 240


14930R-1.IR_full       241 ATCCATACGCCGGTGAAGTCCCTTATTCCCAGCCAGGCATCTCTGCCCTCGCCGACTGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     241 ATCCATACGCCGGTGAAGTCCCTTATTCCCAGCCAGGCATCTCTGCCCTCGCCGACTGTG 300


14930R-1.IR_full       301 AGCCGTGGACTGATGCTGCCCACCTGGCGGCAGTGTCAGATGGGTACAATGGCCGAATTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     301 AGCCGTGGACTGATGCTGCCCACCTGGCGGCAGTGTCAGATGGGTACAATGGCCGAATTG 360


14930R-1.IR_full       361 AAGGACAAGGTCCCTGAGACTCAGCCACCGAATCCCAAGCCCGTGCCACCCCTAACACCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     361 AAGGACAAGGTCCCTGAGACTCAGCCACCGAATCCCAAGCCCGTGCCACCCCTAACACCG 420


14930R-1.IR_full       421 GTAACAGCTTCTACTCCTGGTCTAAACTCTGGCTCCAATTCGATGCTGACTACTGGATCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14930R-1.in silico     421 GTAACAGCTTCTACTCCTGGTCTAAACTCTGGCTCCAATTCGATGCTGACTACTGGATCT 480


14930R-1.IR_full       481 TCAAGCCCGGGTCTTAAGGC 500
                           ||||||||||||||||||||
14930R-1.in silico     481 TCAAGCCCGGGTCTTAAGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135664.2  CG14930-RA (CG14930), mRNA 
96.26   464  NM_135662.3  CG4970-RA, transcript variant A (CG4970), mRNA 
96.26   464  NM_135663.2  CG14929-RA, transcript variant A (CG14929), mRNA 
0   NM_142255.2  CG4221-RA (CG4221), mRNA 
0   NM_165220.1  CG6605-RA (BicD), mRNA 
0   NM_078537.2  CG10966-RA, transcript variant A (rdgA), mRNA 
0   NM_001042799.1  CG10966-RB, transcript variant B (rdgA), mRNA 
0   NM_001014752.1  CG33525-RF, transcript variant F (CG33525), mRNA 
0   NM_001014753.1  CG33525-RE, transcript variant E (CG33525), mRNA 
0   NM_169970.1  CG6703-RA, transcript variant A (Caki), mRNA 
0   NM_169971.1  CG6703-RC, transcript variant C (Caki), mRNA 
0   NM_079717.2  CG6703-RB, transcript variant B (Caki), mRNA 
0   NM_057276.3  CG4178-RA (Lsp1beta), mRNA 
0   NM_130724.2  CG2934-RA (VhaAC39), mRNA 
0   NM_169252.1  CG11984-RA, transcript variant A (CG11984), mRNA 
0   NM_169253.1  CG11984-RC, transcript variant C (CG11984), mRNA 
0   NM_141604.2  CG11984-RB, transcript variant B (CG11984), mRNA 
0   11  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_078557.4  CG1615-RB, transcript variant B (Ork1), mRNA 
0   NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_206750.1  CG15603-RA (CG15603), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_001038900.1  CG11583-RA (CG11583), mRNA 
0   NM_132758.1  CG9504-RA (Eo), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   NM_132544.1  CG18130-RA (CG18130), mRNA 
0   NM_169588.1  CG31317-RA, transcript variant A (stumps), mRNA 
0   NM_169589.1  CG31317-RB, transcript variant B (stumps), mRNA 
0   NM_135749.2  CG5983-RA, transcript variant A (ACXC), mRNA 
0   NM_001038813.1  CG5983-RB, transcript variant B (ACXC), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.