National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14895R-2 
 Symbol Pak3  Full Name Pak3 
 CG No CG14895  Old CG No CG14895 
 Synonyms PaK3, DmPAK3, CG14895, D-Pak3, DPAK3, pak3, dPAK3, PAK3, anon-WO0118547.285, Pak3 
 Accession No (Link to NCBI) NM_142288.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGATGGGGGATCGATCTCA 
 Primer Seq. 3'
aatctagaggtaccCGGTGCTCCAGATTGGTCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNAGATGGGG GATCGATCTC AGAGATCGGT GCACCCACAA ACTTCCAACG NCACTTCCAT 
0061 GTCTCGCGCA ACCAGGAAAC CGGCGACCTG GAGGGGCTTC CAGCTCCATG GGTGCGCCTA 
0121 ATGAACTCAC AGATCACTCG CGATGAGCAG GACAAGAATC CAGATGCTGC CTACCATGCC 
0181 GTTAAGTACT ACAACTATTC GATTAAGAAG AAAGAGAACG AGGTCTTCAA GCCCTTCATC 
0241 ACCGAAGATG TGATCCGCGA GGAGTCCAAG GAGATAGAAA ACTATGTCAA CTACAAAAAC 
0301 AAGCACAAGT CTCAGGATCC CGAAAAGTCC GACGACGATG GCAGTTCGAC GGCCACGGAG 
0361 ACGGAAAGTA GCAGCGGTTG TGGCTCCTCG GCAGGTAATA GTAACAGCAG CAGCATCAAC 
0421 GACAGCAGCC AGCAGTCGAC GGTGCCgCTG GACGCCCTAG AGGAGGTGTT CAAGGAGCTC 
0481 AAGACCAATC TGGAGCACCG  
 in silico PCR Fragment
0001 GGAGATGGGG GATCGATCTC AGAGATCGGT GCACCCACAA ACTTCCAACG GCACTTCCAT 
0061 GTCTCGCGCA ACCAGGAAAC CGGCGACCTG GAGGGGCTTC CAGCTCCATG GGTGCGCCTA 
0121 ATGAACTCAC AGATCACTCG CGATGAGCAG GACAAGAATC CAGATGCTGC CTACCATGCC 
0181 GTTAAGTACT ACAACTATTC GATTAAGAAG AAAGAGAACG AGGTCTTCAA GCCCTTCATC 
0241 ACCGAAGATG TGATCCACGA GGAGTCCAAG GAGATAGAAA ACTATGTCAA CTACAAAAAC 
0301 AAGCACAAGT CTCAGGATCC CGAAAAGTCC GACGACGATG GCAGTTCGAC GGCCACGGAG 
0361 ACGGAAAGTA GCAGCGGTTG TGGCTCCTCG GCAGGTAATA GTAACAGCAG CAGCATCAAC 
0421 GACAGCAGCC AGCAGTCGAC GGTGCCGCTG GACGCCCTAG AGGAGGTGTT CAAGGAGCTC 
0481 AAGACCAATC TGGAGCACCG  
 Assemble Data

14895R-2.IR_full       1   GNAGATGGGGGATCGATCTCAGAGATCGGTGCACCCACAAACTTCCAACGNCACTTCCAT 60
                           | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
14895R-2.in silico     1   GGAGATGGGGGATCGATCTCAGAGATCGGTGCACCCACAAACTTCCAACGGCACTTCCAT 60


14895R-2.IR_full       61  GTCTCGCGCAACCAGGAAACCGGCGACCTGGAGGGGCTTCCAGCTCCATGGGTGCGCCTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14895R-2.in silico     61  GTCTCGCGCAACCAGGAAACCGGCGACCTGGAGGGGCTTCCAGCTCCATGGGTGCGCCTA 120


14895R-2.IR_full       121 ATGAACTCACAGATCACTCGCGATGAGCAGGACAAGAATCCAGATGCTGCCTACCATGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14895R-2.in silico     121 ATGAACTCACAGATCACTCGCGATGAGCAGGACAAGAATCCAGATGCTGCCTACCATGCC 180


14895R-2.IR_full       181 GTTAAGTACTACAACTATTCGATTAAGAAGAAAGAGAACGAGGTCTTCAAGCCCTTCATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14895R-2.in silico     181 GTTAAGTACTACAACTATTCGATTAAGAAGAAAGAGAACGAGGTCTTCAAGCCCTTCATC 240


14895R-2.IR_full       241 ACCGAAGATGTGATCCGCGAGGAGTCCAAGGAGATAGAAAACTATGTCAACTACAAAAAC 300
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
14895R-2.in silico     241 ACCGAAGATGTGATCCACGAGGAGTCCAAGGAGATAGAAAACTATGTCAACTACAAAAAC 300


14895R-2.IR_full       301 AAGCACAAGTCTCAGGATCCCGAAAAGTCCGACGACGATGGCAGTTCGACGGCCACGGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14895R-2.in silico     301 AAGCACAAGTCTCAGGATCCCGAAAAGTCCGACGACGATGGCAGTTCGACGGCCACGGAG 360


14895R-2.IR_full       361 ACGGAAAGTAGCAGCGGTTGTGGCTCCTCGGCAGGTAATAGTAACAGCAGCAGCATCAAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14895R-2.in silico     361 ACGGAAAGTAGCAGCGGTTGTGGCTCCTCGGCAGGTAATAGTAACAGCAGCAGCATCAAC 420


14895R-2.IR_full       421 GACAGCAGCCAGCAGTCGACGGTGCCGCTGGACGCCCTAGAGGAGGTGTTCAAGGAGCTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14895R-2.in silico     421 GACAGCAGCCAGCAGTCGACGGTGCCGCTGGACGCCCTAGAGGAGGTGTTCAAGGAGCTC 480


14895R-2.IR_full       481 AAGACCAATCTGGAGCACCG 500
                           ||||||||||||||||||||
14895R-2.in silico     481 AAGACCAATCTGGAGCACCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142288.2  CG14895-RA, transcript variant A (Pak3), mRNA 
47.92   231  NM_169719.1  CG14895-RB, transcript variant B (Pak3), mRNA 
0   11  65  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   27  179  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   11  55  NM_133033.1  CG12672-RA (CG12672), mRNA 
0   90  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
0   55  NM_135615.2  CG6700-RA (CG6700), mRNA 
0   19  45  NM_141216.2  CG14650-RA (CG14650), mRNA 
0   18  85  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
0   12  73  NM_001014517.1  CG2368-RL, transcript variant L (psq), mRNA 
0   12  73  NM_001014520.1  CG2368-RI, transcript variant I (psq), mRNA 
0   12  73  NM_001014518.1  CG2368-RK, transcript variant K (psq), mRNA 
0   12  73  NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 
0   12  72  NM_165792.1  CG2368-RE, transcript variant E (psq), mRNA 
0   12  72  NM_176142.1  CG2368-RG, transcript variant G (psq), mRNA 
0   12  72  NM_176141.1  CG2368-RF, transcript variant F (psq), mRNA 
0   12  72  NM_206086.1  CG2368-RC, transcript variant C (psq), mRNA 
0   12  72  NM_165790.1  CG2368-RA, transcript variant A (psq), mRNA 
0   12  72  NM_165791.1  CG2368-RD, transcript variant D (psq), mRNA 
0   12  72  NM_176143.1  CG2368-RH, transcript variant H (psq), mRNA 
0   12  72  NM_078962.2  CG2368-RB, transcript variant B (psq), mRNA 
0   10  NM_136069.2  CG10600-RA (CG10600), mRNA 
0   17  NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   NM_133091.2  CG6578-RA (phm), mRNA 
0   45  125  NM_078797.2  CG13109-RA (tai), mRNA 
0   23  NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   19  NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   19  NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   19  NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.