National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14895R-1 
 Symbol Pak3  Full Name Pak3 
 CG No CG14895  Old CG No CG14895 
 Synonyms PaK3, DmPAK3, CG14895, D-Pak3, DPAK3, pak3, dPAK3, PAK3, anon-WO0118547.285, Pak3 
 Accession No (Link to NCBI) NM_142288.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Baek SH, Cho HW, Kwon YC, Lee JH, Kim MJ, Lee H, Choe KM.
Requirement for Pak3 in Rac1-induced organization of actin and myosin during Drosophila larval wound healing.
FEBS Lett (2012) 586(6) 772-7 [ PubMed ID = 22449966 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     1   GGAGATGGGGGATCGATCTCAGAGATCGGTGCACCCACAAACTTCCAACGGCACTTCCAT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTCTCGCGCAACCAGGAAACCGGCGACCTGGAGGGGCTTCCAGCTCCATGGGTGCGCCTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGAACTCACAGATCACTCGCGATGAGCAGGACAAGAATCCAGATGCTGCCTACCATGCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTTAAGTACTACAACTATTCGATTAAGAAGAAAGAGAACGAGGTCTTCAAGCCCTTCATC 240

                           |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCGAAGATGTGATCCACGAGGAGTCCAAGGAGATAGAAAACTATGTCAACTACAAAAAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAGCACAAGTCTCAGGATCCCGAAAAGTCCGACGACGATGGCAGTTCGACGGCCACGGAG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACGGAAAGTAGCAGCGGTTGTGGCTCCTCGGCAGGTAATAGTAACAGCAGCAGCATCAAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GACAGCAGCCAGCAGTCGACGGTGCCGCTGGACGCCCTAGAGGAGGTGTTCAAGGAGCTC 480

14895R-1.IR_full       481 AAGACCAATCTGGAGCACCG 500
                           |||||||||||||||||||| silico     481 AAGACCAATCTGGAGCACCG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142288.2  CG14895-RA, transcript variant A (Pak3), mRNA 
47.92   231  NM_169719.1  CG14895-RB, transcript variant B (Pak3), mRNA 
0   11  65  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   27  179  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   11  55  NM_133033.1  CG12672-RA (CG12672), mRNA 
0   90  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
0   55  NM_135615.2  CG6700-RA (CG6700), mRNA 
0   19  45  NM_141216.2  CG14650-RA (CG14650), mRNA 
0   18  85  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
0   12  73  NM_001014517.1  CG2368-RL, transcript variant L (psq), mRNA 
0   12  73  NM_001014520.1  CG2368-RI, transcript variant I (psq), mRNA 
0   12  73  NM_001014518.1  CG2368-RK, transcript variant K (psq), mRNA 
0   12  73  NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 
0   12  72  NM_165792.1  CG2368-RE, transcript variant E (psq), mRNA 
0   12  72  NM_176142.1  CG2368-RG, transcript variant G (psq), mRNA 
0   12  72  NM_176141.1  CG2368-RF, transcript variant F (psq), mRNA 
0   12  72  NM_206086.1  CG2368-RC, transcript variant C (psq), mRNA 
0   12  72  NM_165790.1  CG2368-RA, transcript variant A (psq), mRNA 
0   12  72  NM_165791.1  CG2368-RD, transcript variant D (psq), mRNA 
0   12  72  NM_176143.1  CG2368-RH, transcript variant H (psq), mRNA 
0   12  72  NM_078962.2  CG2368-RB, transcript variant B (psq), mRNA 
0   10  NM_136069.2  CG10600-RA (CG10600), mRNA 
0   17  NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   NM_133091.2  CG6578-RA (phm), mRNA 
0   45  125  NM_078797.2  CG13109-RA (tai), mRNA 
0   23  NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   19  NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   19  NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   19  NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.