National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14894R-2 
 Symbol CG14894  Full Name CG14894 
 CG No CG14894  Old CG No CG14894 
 Synonyms CG14894 
 Accession No (Link to NCBI) NM_142286.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGGCAACGCCAACAGTGACG 
 Primer Seq. 3'
aatctagaggtaccCCTCACATACTCCGGCCACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGGCAACGC CAACAGTGAC GACGAATTCC ATGATGCGAT CGGGGAGGAG ATAACCGAAA 
0061 AAGAGGCCAC CAGCACGCGG CAGANCGANA AGGACGTGGA TGAGATCGTG GAGAAGCAAA 
0121 ACCAGCTGGC GTTGGATGAC GAAGCGGAAC AGGGCGCGGC TGGCGGAGAT TCCATCGCGA 
0181 CACCAACGAC AGTGGACTCT GAGCTAACCA TTGAGGAGTT GCGCGAACGG GAGAAGGATC 
0241 TCAGCCCAGA GCAGCTGACA GCTAACAAAG AAAAGGCCGA TAAGCTGAAA GTTGAGGGCA 
0301 ACGAGTTGTT CAAAAATGAC GACGCCGAAN GCGCCGCCAA GACCTACACA GAAGCTTTAG 
0361 ACATTTGCCC CTCGGCCAAC TCCAAGGAGC GAGCAGTTCT CTACGGAAAC AGGGCTGCTG 
0421 CCAAGATTAA GCTGGAGGCC AACAAAGCGG CCATCGACGA CTGCACAAAG GCTATAGAAC 
0481 TGTGGCCGGA GTATGTGAGG  
 in silico PCR Fragment
0001 CAGGCAACGC CAACAGTGAC GACGAATTCC ATGATGCGAT CGGGGAGGAG ATAACCGAAA 
0061 AAGAGGCCAC CAGCACGCGG CAGAGCGAAA AGGACGTGGA TGAGATCGTG GAGAAGCAAA 
0121 ACCAGCTGGC GTTGGATGAC GAAGCGGAAC AGGGCGCGGC TGGTGGAGAT TCCATCGCGA 
0181 CACCAACGAC AGTGGACTCT GAGCTAACCA TTGAGGAGTT GCGCGAACGG GAGAAGGATC 
0241 TCAGCCCAGA GCAGCTGACA GCTAACAAAG AAAAGGCCGA TAAGCTGAAA GTTGAGGGCA 
0301 ACGAGTTGTT CAAAAATGAC GACGCCGAAG GCGCCGCCAA GACCTACACA GAAGCCTTAG 
0361 ACATTTGCCC CTCGGCCAGC TCCAAGGAGC GAGCAGTTCT CTACGGAAAC AGGGCTGCTG 
0421 CCAAGATTAA GCTGGAGGCC AACAAAGCGG CCATCGACGA CTGCACAAAG GCTATAGAAC 
0481 TGTGGCCGGA GTATGTGAGG  
 Assemble Data

14894R-2.IR_full       1   CAGGCAACGCCAACAGTGACGACGAATTCCATGATGCGATCGGGGAGGAGATAACCGAAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14894R-2.in silico     1   CAGGCAACGCCAACAGTGACGACGAATTCCATGATGCGATCGGGGAGGAGATAACCGAAA 60


14894R-2.IR_full       61  AAGAGGCCACCAGCACGCGGCAGANCGANAAGGACGTGGATGAGATCGTGGAGAAGCAAA 120
                           |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||
14894R-2.in silico     61  AAGAGGCCACCAGCACGCGGCAGAGCGAAAAGGACGTGGATGAGATCGTGGAGAAGCAAA 120


14894R-2.IR_full       121 ACCAGCTGGCGTTGGATGACGAAGCGGAACAGGGCGCGGCTGGCGGAGATTCCATCGCGA 180
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
14894R-2.in silico     121 ACCAGCTGGCGTTGGATGACGAAGCGGAACAGGGCGCGGCTGGTGGAGATTCCATCGCGA 180


14894R-2.IR_full       181 CACCAACGACAGTGGACTCTGAGCTAACCATTGAGGAGTTGCGCGAACGGGAGAAGGATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14894R-2.in silico     181 CACCAACGACAGTGGACTCTGAGCTAACCATTGAGGAGTTGCGCGAACGGGAGAAGGATC 240


14894R-2.IR_full       241 TCAGCCCAGAGCAGCTGACAGCTAACAAAGAAAAGGCCGATAAGCTGAAAGTTGAGGGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14894R-2.in silico     241 TCAGCCCAGAGCAGCTGACAGCTAACAAAGAAAAGGCCGATAAGCTGAAAGTTGAGGGCA 300


14894R-2.IR_full       301 ACGAGTTGTTCAAAAATGACGACGCCGAANGCGCCGCCAAGACCTACACAGAAGCTTTAG 360
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||
14894R-2.in silico     301 ACGAGTTGTTCAAAAATGACGACGCCGAAGGCGCCGCCAAGACCTACACAGAAGCCTTAG 360


14894R-2.IR_full       361 ACATTTGCCCCTCGGCCAACTCCAAGGAGCGAGCAGTTCTCTACGGAAACAGGGCTGCTG 420
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
14894R-2.in silico     361 ACATTTGCCCCTCGGCCAGCTCCAAGGAGCGAGCAGTTCTCTACGGAAACAGGGCTGCTG 420


14894R-2.IR_full       421 CCAAGATTAAGCTGGAGGCCAACAAAGCGGCCATCGACGACTGCACAAAGGCTATAGAAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14894R-2.in silico     421 CCAAGATTAAGCTGGAGGCCAACAAAGCGGCCATCGACGACTGCACAAAGGCTATAGAAC 480


14894R-2.IR_full       481 TGTGGCCGGAGTATGTGAGG 500
                           ||||||||||||||||||||
14894R-2.in silico     481 TGTGGCCGGAGTATGTGAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142286.2  CG14894-RA (CG14894), mRNA 
0   NM_136413.1  CG12836-RA (CG12836), mRNA 
0   NM_137567.1  CG9811-RA (Rgk1), mRNA 
0   NM_143588.2  CG15556-RA (CG15556), mRNA 
0   NM_136069.2  CG10600-RA (CG10600), mRNA 
0   NM_134947.1  CG15415-RA (CG15415), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_139889.1  CG7492-RA (CG7492), mRNA 
0   NM_057382.2  CG16738-RA (slp1), mRNA 
0   NM_165112.1  CG31829-RA (CG31829), mRNA 
0   13  NM_001043289.1  CG34100-RA, transcript variant A (mld), mRNA 
0   NM_078659.3  CG5055-RA, transcript variant A (baz), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_142793.2  CG7054-RA (CG7054), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_141779.2  CG6621-RA (CG6621), mRNA 
0   NM_134724.2  CG4710-RA, transcript variant A (smi21F), mRNA 
0   NM_164405.1  CG4710-RB, transcript variant B (smi21F), mRNA 
0   NM_136864.2  CG13185-RA (CG13185), mRNA 
0   12  NM_137821.2  CG10955-RA (CG10955), mRNA 
0   NM_137288.2  CG4439-RA (CG4439), mRNA 
0   NM_166809.1  CG11154-RB, transcript variant B (ATPsyn-beta), mRNA 
0   NM_166808.1  CG11154-RA, transcript variant A (ATPsyn-beta), mRNA 
0   NM_137347.2  CG15605-RA (CG15605), mRNA 
0   NM_136786.2  CG11979-RA (Rpb5), mRNA 
0   15  NM_169056.1  CG31550-RB, transcript variant B (CG31550), mRNA 
0   12  NM_167848.1  CG18214-RD, transcript variant D (trio), mRNA 
0   11  NM_080325.3  CG6450-RC (lva), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.