National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14884R-3 
 Symbol CSN5  Full Name COP9 complex homolog subunit 5 
 CG No CG14884  Old CG No CG14884 
 Synonyms jab1/csn5, csn5, Dch5, quo, JAB1/CSN5, Csn5, Jab1, l(3)L4032, DCH5, BcDNA.LD14392, dch5, JadBp, l(3)89Cf, l(3)M203, CH5, CG14884, BcDNA:LD14392, CSN5 
 Accession No (Link to NCBI) NM_058094.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) 145(22) [ PubMed ID = 30333215 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGACTCCGACGCCGCACAA 
 Primer Seq. 3'
aatctagaggtaccACCACAATGGCCACGAATGGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGACTCCG ACGCCGCACA AAAGACCTGG GAGCTGGAGA ACAACATCCA GACGTTGCCC 
0061 AGTTGTGACG AGATCTTTCG CTACGACGCC GAACAGCAGC GGCAGATCAT CGATGCGAAG 
0121 CCCTGGGAGA AAGATCCCCA CTTCTTTAAG GACATTAAGA TCTCGGCTCT GGCGCTCCTA 
0181 AAGATGGTGA TGCACGCTCG CTCTGGCGGT ACTTTGGAGG TGATGGGTCT AATGCTTGGC 
0241 AAGGTAGAGG ACAACACAAT GATTGTCATG GATGCATTTG CACTGCCAGT GGAGGGCACT 
0301 GAAACCCGCG TCAATGCCCA GGCACAAGCG TACGAGTACA TGACCGCCTA CATGGAAGCG 
0361 GCCAAAGAGG TGGGACGCAT GGAACACGCC GTGGGCTGGT ATCACAGCCA TCCCGGTTAC 
0421 GGTTGCTGGT TGTCCGGCAT CGATGTGTCC ACCCAGATGC TCAACCAGAC ATACCAGGAG 
0481 CCATTCGTGG CCATTGTGGT  
 in silico PCR Fragment
0001 ATGGACTCCG ACGCCGCACA AAAGACCTGG GAGCTGGAGA ACAACATCCA GACGTTGCCC 
0061 AGTTGTGACG AGATCTTTCG CTACGACGCC GAACAGCAGC GGCAGATCAT CGATGCGAAG 
0121 CCCTGGGAGA AAGATCCCCA CTTCTTTAAG GACATTAAGA TCTCGGCTCT GGCGCTCCTA 
0181 AAGATGGTGA TGCACGCTCG CTCTGGCGGT ACTTTGGAGG TGATGGGTCT AATGCTTGGC 
0241 AAGGTAGAGG ACAACACAAT GATTGTCATG GATGCATTTG CACTGCCAGT GGAGGGCACT 
0301 GAAACCCGCG TCAATGCCCA GGCACAAGCG TACGAGTACA TGACCGCCTA CATGGAAGCG 
0361 GCCAAAGAGG TGGGACGCAT GGAACACGCC GTGGGCTGGT ATCACAGCCA TCCCGGTTAC 
0421 GGTTGCTGGT TGTCCGGCAT CGATGTGTCC ACCCAGATGC TCAACCAGAC ATACCAGGAG 
0481 CCATTCGTGG CCATTGTGGT  
 Assemble Data

14884R-3.IR_full       1   ATGGACTCCGACGCCGCACAAAAGACCTGGGAGCTGGAGAACAACATCCAGACGTTGCCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     1   ATGGACTCCGACGCCGCACAAAAGACCTGGGAGCTGGAGAACAACATCCAGACGTTGCCC 60


14884R-3.IR_full       61  AGTTGTGACGAGATCTTTCGCTACGACGCCGAACAGCAGCGGCAGATCATCGATGCGAAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     61  AGTTGTGACGAGATCTTTCGCTACGACGCCGAACAGCAGCGGCAGATCATCGATGCGAAG 120


14884R-3.IR_full       121 CCCTGGGAGAAAGATCCCCACTTCTTTAAGGACATTAAGATCTCGGCTCTGGCGCTCCTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     121 CCCTGGGAGAAAGATCCCCACTTCTTTAAGGACATTAAGATCTCGGCTCTGGCGCTCCTA 180


14884R-3.IR_full       181 AAGATGGTGATGCACGCTCGCTCTGGCGGTACTTTGGAGGTGATGGGTCTAATGCTTGGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     181 AAGATGGTGATGCACGCTCGCTCTGGCGGTACTTTGGAGGTGATGGGTCTAATGCTTGGC 240


14884R-3.IR_full       241 AAGGTAGAGGACAACACAATGATTGTCATGGATGCATTTGCACTGCCAGTGGAGGGCACT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     241 AAGGTAGAGGACAACACAATGATTGTCATGGATGCATTTGCACTGCCAGTGGAGGGCACT 300


14884R-3.IR_full       301 GAAACCCGCGTCAATGCCCAGGCACAAGCGTACGAGTACATGACCGCCTACATGGAAGCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     301 GAAACCCGCGTCAATGCCCAGGCACAAGCGTACGAGTACATGACCGCCTACATGGAAGCG 360


14884R-3.IR_full       361 GCCAAAGAGGTGGGACGCATGGAACACGCCGTGGGCTGGTATCACAGCCATCCCGGTTAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     361 GCCAAAGAGGTGGGACGCATGGAACACGCCGTGGGCTGGTATCACAGCCATCCCGGTTAC 420


14884R-3.IR_full       421 GGTTGCTGGTTGTCCGGCATCGATGTGTCCACCCAGATGCTCAACCAGACATACCAGGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14884R-3.in silico     421 GGTTGCTGGTTGTCCGGCATCGATGTGTCCACCCAGATGCTCAACCAGACATACCAGGAG 480


14884R-3.IR_full       481 CCATTCGTGGCCATTGTGGT 500
                           ||||||||||||||||||||
14884R-3.in silico     481 CCATTCGTGGCCATTGTGGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058094.3  CG14884-RA (CSN5), mRNA 
0.41   NM_132608.2  CG32649-RA (CG32649), mRNA 
0   28  NM_135061.2  CG18174-RA (Rpn11), mRNA 
0   NM_135201.1  CG9595-RA (osm-6), mRNA 
0   NM_079702.2  CG3637-RA (Cortactin), mRNA 
0   NM_130665.2  CG2680-RA (CG2680), mRNA 
0   NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   NM_001015186.1  CG40177-PA.3 (CG40177), mRNA 
0   NM_165289.1  CG17549-RC, transcript variant C (CG17549), mRNA 
0   NM_165288.1  CG17549-RB, transcript variant B (CG17549), mRNA 
0   NM_168906.1  CG5081-RB, transcript variant B (Syx7), mRNA 
0   NM_168905.1  CG5081-RA, transcript variant A (Syx7), mRNA 
0   NM_137761.2  CG10307-RA (CG10307), mRNA 
0   NM_143149.1  CG5071-RB, transcript variant B (CG5071), mRNA 
0   NM_170232.1  CG5071-RA, transcript variant A (CG5071), mRNA 
0   NM_142696.1  CG7000-RA (CG7000), mRNA 
0   NM_131991.2  CG3252-RA (CG3252), mRNA 
0   NM_141774.2  CG4596-RA (CG4596), mRNA 
0   NM_139943.1  CG7201-RA (CG7201), mRNA 
0   NM_057515.2  CG6518-RA (inaC), mRNA 
0   NM_132943.1  CG13004-RA (CG13004), mRNA 
0   NM_057686.3  CG4254-RA (tsr), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 
0   14  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   11  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_139513.2  CG7740-RC, transcript variant C (prominin-like), mRNA 
0   NM_167987.1  CG7740-RB, transcript variant B (prominin-like), mRNA 
0   NM_167986.1  CG7740-RA, transcript variant A (prominin-like), mRNA 
0   NM_170411.1  CG2310-RB, transcript variant B (CG2310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.