National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14884R-1 
 Symbol CSN5  Full Name COP9 complex homolog subunit 5 
 CG No CG14884  Old CG No CG14884 
 Synonyms jab1/csn5, csn5, Dch5, quo, JAB1/CSN5, Csn5, Jab1, l(3)L4032, DCH5, BcDNA.LD14392, dch5, JadBp, l(3)89Cf, l(3)M203, CH5, CG14884, BcDNA:LD14392, CSN5 
 Accession No (Link to NCBI) NM_058094.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) 145(22) [ PubMed ID = 30333215 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Zhang J, Liu M, Su Y, Du J, Zhu AJ.
A targeted in vivo RNAi screen reveals deubiquitinases as new regulators of Notch signaling.
G3 (Bethesda) (2012) 2(12) 1563-75 [ PubMed ID = 23275879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGACTCCGACGCCGCACAAAAGACCTGGGAGCTGGAGAACAACATCCAGACGTTGCCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGTTGTGACGAGATCTTTCGCTACGACGCCGAACAGCAGCGGCAGATCATCGATGCGAAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCCTGGGAGAAAGATCCCCACTTCTTTAAGGACATTAAGATCTCGGCTCTGGCGCTCCTA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AAGATGGTGATGCACGCTCGCTCTGGCGGTACTTTGGAGGTGATGGGTCTAATGCTTGGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGGTAGAGGACAACACAATGATTGTCATGGATGCATTTGCACTGCCAGTGGAGGGCACT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAAACCCGCGTCAATGCCCAGGCACAAGCGTACGAGTACATGACCGCCTACATGGAAGCG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCCAAAGAGGTGGGACGCATGGAACACGCCGTGGGCTGGTATCACAGCCATCCCGGTTAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGTTGCTGGTTGTCCGGCATCGATGTGTCCACCCAGATGCTCAACCAGACATACCAGGAG 480

14884R-1.IR_full       481 CCATTCGTGGCCATTGTGGT 500
                           |||||||||||||||||||| silico     481 CCATTCGTGGCCATTGTGGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058094.3  CG14884-RA (CSN5), mRNA 
0.41   NM_132608.2  CG32649-RA (CG32649), mRNA 
0   28  NM_135061.2  CG18174-RA (Rpn11), mRNA 
0   NM_135201.1  CG9595-RA (osm-6), mRNA 
0   NM_079702.2  CG3637-RA (Cortactin), mRNA 
0   NM_130665.2  CG2680-RA (CG2680), mRNA 
0   NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   NM_001015186.1  CG40177-PA.3 (CG40177), mRNA 
0   NM_165289.1  CG17549-RC, transcript variant C (CG17549), mRNA 
0   NM_165288.1  CG17549-RB, transcript variant B (CG17549), mRNA 
0   NM_168906.1  CG5081-RB, transcript variant B (Syx7), mRNA 
0   NM_168905.1  CG5081-RA, transcript variant A (Syx7), mRNA 
0   NM_137761.2  CG10307-RA (CG10307), mRNA 
0   NM_143149.1  CG5071-RB, transcript variant B (CG5071), mRNA 
0   NM_170232.1  CG5071-RA, transcript variant A (CG5071), mRNA 
0   NM_142696.1  CG7000-RA (CG7000), mRNA 
0   NM_131991.2  CG3252-RA (CG3252), mRNA 
0   NM_141774.2  CG4596-RA (CG4596), mRNA 
0   NM_139943.1  CG7201-RA (CG7201), mRNA 
0   NM_057515.2  CG6518-RA (inaC), mRNA 
0   NM_132943.1  CG13004-RA (CG13004), mRNA 
0   NM_057686.3  CG4254-RA (tsr), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 
0   14  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   11  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_139513.2  CG7740-RC, transcript variant C (prominin-like), mRNA 
0   NM_167987.1  CG7740-RB, transcript variant B (prominin-like), mRNA 
0   NM_167986.1  CG7740-RA, transcript variant A (prominin-like), mRNA 
0   NM_170411.1  CG2310-RB, transcript variant B (CG2310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.