National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14883R-3 
 Symbol CG14883  Full Name CG14883 
 CG No CG14883  Old CG No CG14883 
 Synonyms CG14883 
 Accession No (Link to NCBI) NM_142290.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGTTGTGGCTGGCGCTCAAA 
 Primer Seq. 3'
aatctagaggtaccTCCAGGAAATCGGACAATTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGTTGTGGC TGGCGCTCAA AATGATTTAC CAGCTGCTGT gCTGCTCCGT GAGTCTGATC 
0061 TTCTTCTGCT TCAACGTATT CTGGCTCTTT TGCAACCTGG CCATCCCGTG GTGCACTCTT 
0121 ACCTTGCTCG TTGTGTGCAT CNGCCTCCAA GTTCGTCAAA CTGCAACGAA GTCCCAACGA 
0181 GAAGCGACTC CTAAGCCTTC TGAGTTCTCC AGAGGAATGG CCCAGTTACT GGCCAATCGC 
0241 CAACCGGGCA GCCGGCTTTG ATGCGCCCGA AAACTCCAAG GCAGCCATTA AGAANTGCCT 
0301 CGCACGTGGA TATCGGAACG TGCTTCTGGA TGNCgGCCTC ACGTCCTGTG GTGAAATAGT 
0361 CGTGGCTAAC CCCACAAAAA TAAACGTTGc ACAGCCGCTT GTGGAGTTGC AAAAGCTAAA 
0421 CATCACGGAG CAACAcCCGA TGGGGTCGCA GTACGAAGCG GAAACGGTGG CTCCCCTCAG 
0481 GCAATTGTCC GATTTCCTGG A 
 in silico PCR Fragment
0001 TTGTTGTGGC TGGCGCTCAA AATGATTTAC CAGCTGCTGT GCTGCTCCGT GAGTCTGATC 
0061 TTCTTCTGCT TCAACGTATT CTGGCTCTTT TGCAACCTGG CCATCCCGTG GTGCACTCTT 
0121 ACCTTGCTCG TTGTGTGCAT C-GCCTCCAA GTTCGTCAAA CTGCAACGAA GTCCCAACGA 
0181 GAAGCGACTC CTAAGCCTTC TGAGTTCTCC AGAGGAATGG CCCAGTTACT GGCCAATCGC 
0241 CAACCGGGCA GCCGGCTTTG ATGCGCCCGA AAACTCCAAG GCAGCCATTA AGAAGTGCCT 
0301 CGCACGTGGA TATCGGAACG TGCTTCTGGA TGCCGGCCTC ACGTCCTGTG GTGAAATAGT 
0361 CGTGGCTAAC CCCACAAAAA TAAACGTTGC ACAGCCGCTT GTGGAGTTGC AAAAGCTAAA 
0421 CATCACGGAG CAACACCCGA TGGGGTCGCA GTACGAAGCG GAAACGGTGG CTCCCCTCAG 
0481 GCAATTGTCC GATTTCCTGG A 
 Assemble Data

14883R-3.IR_full       1   TTGTTGTGGCTGGCGCTCAAAATGATTTACCAGCTGCTGTGCTGCTCCGTGAGTCTGATC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14883R-3.in silico     1   TTGTTGTGGCTGGCGCTCAAAATGATTTACCAGCTGCTGTGCTGCTCCGTGAGTCTGATC 60


14883R-3.IR_full       61  TTCTTCTGCTTCAACGTATTCTGGCTCTTTTGCAACCTGGCCATCCCGTGGTGCACTCTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14883R-3.in silico     61  TTCTTCTGCTTCAACGTATTCTGGCTCTTTTGCAACCTGGCCATCCCGTGGTGCACTCTT 120


14883R-3.IR_full       121 ACCTTGCTCGTTGTGTGCATCNGCCTCCAAGTTCGTCAAACTGCAACGAAGTCCCAACGA 180
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
14883R-3.in silico     121 ACCTTGCTCGTTGTGTGCATC-GCCTCCAAGTTCGTCAAACTGCAACGAAGTCCCAACGA 180


14883R-3.IR_full       181 GAAGCGACTCCTAAGCCTTCTGAGTTCTCCAGAGGAATGGCCCAGTTACTGGCCAATCGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14883R-3.in silico     181 GAAGCGACTCCTAAGCCTTCTGAGTTCTCCAGAGGAATGGCCCAGTTACTGGCCAATCGC 240


14883R-3.IR_full       241 CAACCGGGCAGCCGGCTTTGATGCGCCCGAAAACTCCAAGGCAGCCATTAAGAANTGCCT 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
14883R-3.in silico     241 CAACCGGGCAGCCGGCTTTGATGCGCCCGAAAACTCCAAGGCAGCCATTAAGAAGTGCCT 300


14883R-3.IR_full       301 CGCACGTGGATATCGGAACGTGCTTCTGGATGNCGGCCTCACGTCCTGTGGTGAAATAGT 360
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
14883R-3.in silico     301 CGCACGTGGATATCGGAACGTGCTTCTGGATGCCGGCCTCACGTCCTGTGGTGAAATAGT 360


14883R-3.IR_full       361 CGTGGCTAACCCCACAAAAATAAACGTTGCACAGCCGCTTGTGGAGTTGCAAAAGCTAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14883R-3.in silico     361 CGTGGCTAACCCCACAAAAATAAACGTTGCACAGCCGCTTGTGGAGTTGCAAAAGCTAAA 420


14883R-3.IR_full       421 CATCACGGAGCAACACCCGATGGGGTCGCAGTACGAAGCGGAAACGGTGGCTCCCCTCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14883R-3.in silico     421 CATCACGGAGCAACACCCGATGGGGTCGCAGTACGAAGCGGAAACGGTGGCTCCCCTCAG 480


14883R-3.IR_full       481 GCAATTGTCCGATTTCCTGGA 501
                           |||||||||||||||||||||
14883R-3.in silico     481 GCAATTGTCCGATTTCCTGGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142290.1  CG14883-RA (CG14883), mRNA 
0   NM_175947.1  CG33128-RA (CG33128), mRNA 
0   NM_135887.2  CG3491-RA (CG3491), mRNA 
0   NM_144370.2  CG17932-RA, transcript variant A (Ugt36Bc), mRNA 
0   NM_165193.1  CG17932-RB, transcript variant B (Ugt36Bc), mRNA 
0   NM_135811.2  CG9267-RA (CG9267), mRNA 
0   NM_134906.1  CG12400-RA (CG12400), mRNA 
0   NM_139949.2  CG7185-RA (CG7185), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_176414.1  CG1988-RB, transcript variant B (CG1988), mRNA 
0   NM_140493.2  CG16959-RA, transcript variant A (CG16959), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_141430.2  CG1988-RA, transcript variant A (CG1988), mRNA 
0   NM_136542.1  CG30361-RA, transcript variant A (mXr), mRNA 
0   NM_135983.1  CG15136-RA (CG15136), mRNA 
0   NM_165301.1  CG10026-RA, transcript variant A (CG10026), mRNA 
0   NM_136124.2  CG10026-RB, transcript variant B (CG10026), mRNA 
0   NM_165302.2  CG10026-RC, transcript variant C (CG10026), mRNA 
0   NM_135292.1  CG13793-RA (CG13793), mRNA 
0   NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 
0   NM_080330.2  CG3620-RA, transcript variant A (norpA), mRNA 
0   NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 
0   NM_001014720.1  CG3620-RD, transcript variant D (norpA), mRNA 
0   NM_001043086.1  CG30084-RG, transcript variant G (CG30084), mRNA 
0   NM_001032250.1  CG30084-RE, transcript variant E (CG30084), mRNA 
0   NM_137283.2  CG7848-RA (CG7848), mRNA 
0   10  NM_137583.3  CG11228-RA (hpo), mRNA 
0   NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 
0   NM_001032249.1  CG30084-RF, transcript variant F (CG30084), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.