National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14823R-2 
 Symbol CG14823  Full Name CG14823 
 CG No CG14823  Old CG No CG14823 
 Synonyms CG14823 
 Accession No (Link to NCBI) NM_168186.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| silico     1   ATGGAGCCCACATGCAGCAGCAGTGTGGCGG-AATTGGCCAAATACAGTGAGGATGATGT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAAACGGATGAGTCCAAGGTGGTGGAGCATCAGGAATATGCCGAAGCGCTGTCAATGTC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGGGAAAGTCGTAAGCGGAAACGATGGACTCGAAGGTCCTGCTGCACTCGCCAAGTCCT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGTACGGGCGCCATTTTCATCGCCCTTCTGCTCATCATCGGCGCCATTTACATGCACTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGACAGAAGCATCATCTGGGCCGACTGCACATCAATCTCAAGGATCGGGGGCAAGTGGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGTCCTGGAGGAGGACTTTCCCATGGTCACCGCTGCGGGAGTGGATGCCCAGACCTCGAC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATAACAACATTCCAGCCGCCTCCGACATCCTCCCCAGAGCCCAGTGCCAAGTGCCTGGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     421 CTGCATGGCCACCACTGCCACGGATAATATTCCGGCAATCTGCAGGCACCGAGGACGACC 480

14823R-2.IR_full       481 AGAGGAGCCGTGCGGCATTTA 501
                           ||||||||||||||||||||| silico     481 AGAGGAGCCGTGCGGCATTTA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168186.1  CG14823-RA, transcript variant A (CG14823), mRNA 
96.26   464  NM_139817.2  CG14823-RD, transcript variant D (CG14823), mRNA 
72.82   351  NM_168187.1  CG14823-RB, transcript variant B (CG14823), mRNA 
67.42   325  NM_168188.1  CG14823-RC, transcript variant C (CG14823), mRNA 
0   NM_137532.2  CG15096-RA, transcript variant A (CG15096), mRNA 
0   NM_166310.1  CG15096-RB, transcript variant B (CG15096), mRNA 
0   NM_135117.1  CG11034-RA (CG11034), mRNA 
0   NM_079884.3  CG1449-RA (zfh2), mRNA 
0   NM_168399.1  CG32057-RC, transcript variant C (dpr10), mRNA 
0   NM_168397.1  CG32057-RA, transcript variant A (dpr10), mRNA 
0   NM_168398.1  CG32057-RB, transcript variant B (dpr10), mRNA 
0   NM_143201.3  CG14543-RA (CG14543), mRNA 
0   NM_132380.1  CG15311-RA (CG15311), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_164719.1  CG32829-RA (CG32829), mRNA 
0   NM_058032.3  CG12389-RA (Fpps), mRNA 
0   NM_001014569.1  CG33523-RD, transcript variant D (CG33523), mRNA 
0   NM_001014566.1  CG33523-RA, transcript variant A (CG33523), mRNA 
0   NM_001014567.1  CG33523-RC, transcript variant C (CG33523), mRNA 
0   NM_001014568.1  CG33523-RB, transcript variant B (CG33523), mRNA 
0   NM_135407.1  CG9465-RA (CG9465), mRNA 
0   NM_132141.1  CG14431-RA (CG14431), mRNA 
0   NM_079299.2  CG6233-RA (Ufd1-like), mRNA 
0   14  NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_079756.2  CG6383-RA, transcript variant A (crb), mRNA 
0   NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
0   NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_168819.1  CG15881-RA, transcript variant A (CG15881), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.