National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14823R-1 
 Symbol CG14823  Full Name CG14823 
 CG No CG14823  Old CG No CG14823 
 Synonyms CG14823 
 Accession No (Link to NCBI) NM_168186.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAGCCCACATGCAGCAGC 
 Primer Seq. 3'
aatctagaggtaccTAAATGCCGCACGGCTCCTCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGAGCCCA CATGCAGCAG CAGTGTGGCG GTAATTGGCC AAATACAGTG AGGATGATGT 
0061 GGAAACGGAT GAGTCCAAGG TGGTGGAGCA TCAGGAATAT GCCGAAGCGC TGTCAATGTC 
0121 CGGGGAAAGT CGTAAGCGGA AACGATGGAC TCGAAGGTCC TGCTGCACTC GCCAAGTCCT 
0181 GAGTACGGGC GCCATTTTCA TCGCCCTTCT GCTCATCATC GGCGCCATTT ACATGCACTT 
0241 AAGACAGAAG CATCATCTGG GCCGACTGCA CATCAATCTC AAGGATCGGG GGCAAGTGGA 
0301 GGTCCTGGAG GAGGACTTTC CCATGGTCAC CGCTGCGGGA GTGGATGCCC AGACCTCGAC 
0361 GATAACAACA TTCCAGCCGC CTCCGACATC CTCCCCAGAG CCCAGTGCCA AGTGCCTGGA 
0421 CTGCATGGCC ACCACTGCCA CGGATAATAT TCCGGCAATC TGCAGGAACC GAGGACGACC 
0481 AGAGGAGCCG TGCGGCATTT A 
 in silico PCR Fragment
0001 ATGGAGCCCA CATGCAGCAG CAGTGTGGCG G-AATTGGCC AAATACAGTG AGGATGATGT 
0061 GGAAACGGAT GAGTCCAAGG TGGTGGAGCA TCAGGAATAT GCCGAAGCGC TGTCAATGTC 
0121 CGGGGAAAGT CGTAAGCGGA AACGATGGAC TCGAAGGTCC TGCTGCACTC GCCAAGTCCT 
0181 GAGTACGGGC GCCATTTTCA TCGCCCTTCT GCTCATCATC GGCGCCATTT ACATGCACTT 
0241 AAGACAGAAG CATCATCTGG GCCGACTGCA CATCAATCTC AAGGATCGGG GGCAAGTGGA 
0301 GGTCCTGGAG GAGGACTTTC CCATGGTCAC CGCTGCGGGA GTGGATGCCC AGACCTCGAC 
0361 GATAACAACA TTCCAGCCGC CTCCGACATC CTCCCCAGAG CCCAGTGCCA AGTGCCTGGA 
0421 CTGCATGGCC ACCACTGCCA CGGATAATAT TCCGGCAATC TGCAGGCACC GAGGACGACC 
0481 AGAGGAGCCG TGCGGCATTT A 
 Assemble Data

14823R-1.IR_full       1   ATGGAGCCCACATGCAGCAGCAGTGTGGCGGTAATTGGCCAAATACAGTGAGGATGATGT 60
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
14823R-1.in silico     1   ATGGAGCCCACATGCAGCAGCAGTGTGGCGG-AATTGGCCAAATACAGTGAGGATGATGT 60


14823R-1.IR_full       61  GGAAACGGATGAGTCCAAGGTGGTGGAGCATCAGGAATATGCCGAAGCGCTGTCAATGTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14823R-1.in silico     61  GGAAACGGATGAGTCCAAGGTGGTGGAGCATCAGGAATATGCCGAAGCGCTGTCAATGTC 120


14823R-1.IR_full       121 CGGGGAAAGTCGTAAGCGGAAACGATGGACTCGAAGGTCCTGCTGCACTCGCCAAGTCCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14823R-1.in silico     121 CGGGGAAAGTCGTAAGCGGAAACGATGGACTCGAAGGTCCTGCTGCACTCGCCAAGTCCT 180


14823R-1.IR_full       181 GAGTACGGGCGCCATTTTCATCGCCCTTCTGCTCATCATCGGCGCCATTTACATGCACTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14823R-1.in silico     181 GAGTACGGGCGCCATTTTCATCGCCCTTCTGCTCATCATCGGCGCCATTTACATGCACTT 240


14823R-1.IR_full       241 AAGACAGAAGCATCATCTGGGCCGACTGCACATCAATCTCAAGGATCGGGGGCAAGTGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14823R-1.in silico     241 AAGACAGAAGCATCATCTGGGCCGACTGCACATCAATCTCAAGGATCGGGGGCAAGTGGA 300


14823R-1.IR_full       301 GGTCCTGGAGGAGGACTTTCCCATGGTCACCGCTGCGGGAGTGGATGCCCAGACCTCGAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14823R-1.in silico     301 GGTCCTGGAGGAGGACTTTCCCATGGTCACCGCTGCGGGAGTGGATGCCCAGACCTCGAC 360


14823R-1.IR_full       361 GATAACAACATTCCAGCCGCCTCCGACATCCTCCCCAGAGCCCAGTGCCAAGTGCCTGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14823R-1.in silico     361 GATAACAACATTCCAGCCGCCTCCGACATCCTCCCCAGAGCCCAGTGCCAAGTGCCTGGA 420


14823R-1.IR_full       421 CTGCATGGCCACCACTGCCACGGATAATATTCCGGCAATCTGCAGGAACCGAGGACGACC 480
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
14823R-1.in silico     421 CTGCATGGCCACCACTGCCACGGATAATATTCCGGCAATCTGCAGGCACCGAGGACGACC 480


14823R-1.IR_full       481 AGAGGAGCCGTGCGGCATTTA 501
                           |||||||||||||||||||||
14823R-1.in silico     481 AGAGGAGCCGTGCGGCATTTA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168186.1  CG14823-RA, transcript variant A (CG14823), mRNA 
96.26   464  NM_139817.2  CG14823-RD, transcript variant D (CG14823), mRNA 
72.82   351  NM_168187.1  CG14823-RB, transcript variant B (CG14823), mRNA 
67.42   325  NM_168188.1  CG14823-RC, transcript variant C (CG14823), mRNA 
0   NM_137532.2  CG15096-RA, transcript variant A (CG15096), mRNA 
0   NM_166310.1  CG15096-RB, transcript variant B (CG15096), mRNA 
0   NM_135117.1  CG11034-RA (CG11034), mRNA 
0   NM_079884.3  CG1449-RA (zfh2), mRNA 
0   NM_168399.1  CG32057-RC, transcript variant C (dpr10), mRNA 
0   NM_168397.1  CG32057-RA, transcript variant A (dpr10), mRNA 
0   NM_168398.1  CG32057-RB, transcript variant B (dpr10), mRNA 
0   NM_143201.3  CG14543-RA (CG14543), mRNA 
0   NM_132380.1  CG15311-RA (CG15311), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_164719.1  CG32829-RA (CG32829), mRNA 
0   NM_058032.3  CG12389-RA (Fpps), mRNA 
0   NM_001014569.1  CG33523-RD, transcript variant D (CG33523), mRNA 
0   NM_001014566.1  CG33523-RA, transcript variant A (CG33523), mRNA 
0   NM_001014567.1  CG33523-RC, transcript variant C (CG33523), mRNA 
0   NM_001014568.1  CG33523-RB, transcript variant B (CG33523), mRNA 
0   NM_135407.1  CG9465-RA (CG9465), mRNA 
0   NM_132141.1  CG14431-RA (CG14431), mRNA 
0   NM_079299.2  CG6233-RA (Ufd1-like), mRNA 
0   14  NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_079756.2  CG6383-RA, transcript variant A (crb), mRNA 
0   NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
0   NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_168819.1  CG15881-RA, transcript variant A (CG15881), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.