National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14745R-2 
 Symbol PGRP-SC2  Full Name PGRP-SC2 
 CG No CG14745  Old CG No CG14745 
 Synonyms PGRP-SC, CG14745, PGRP-SC2 
 Accession No (Link to NCBI) NM_136566.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Chen H, Zheng X, Zheng Y.
Age-associated loss of lamin-B leads to systemic inflammation and gut hyperplasia.
Cell (2014) 159(4) 829-43 [ PubMed ID = 25417159 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTCTGGCCGTACTCTTCTGC 
 Primer Seq. 3'
aatctagaggtaccTTCCAGATGTTGGTGCCGGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTTCTGGCCG TACTCTTCTG CGCCCAAGCC GTTCTCGGCG TGACCATCAT CTCCAAGTCG 
0061 GAGTGGGGCG GCCGTTCCNC CACGAGCAAG ACCTNCGCTG GCCAACTACC TGAGCTACGC 
0121 CGTGATCCAC CACACCGCTG GAAACTACTG CAGCACCAAG GCCGCCTGCA TCACACAGCT 
0181 GCAGAACATC CAGGCCTACC ACATGGACTC CCTGGGCTGG GCCGATATCG GCTACAACTT 
0241 CCTGATCGGC GGAGACGGCA ACGTGTACGA GGGTCGCGGC TGGAACGTTA TGGGTGCTCA 
0301 CGCCACTAAC TGGAACTCCA AGTCTATCGG CATCTCCTTC CTGGGCAACT ACAATACCAA 
0361 CACCCTCACC TCTGCTCAGA TCACCGCTGC CAAGGGTCTG CTCTCCGATG CGGTCAGTCG 
0421 CGGCCAGATC GTTTCCGGAT ACATCCTGTA NGGACATCGG CAGGTCGGCT CCACCGAgtN 
0481 CCCCGGCACC AACATCTGGA A 
 in silico PCR Fragment
0001 CTTCTGGCCG TACTCTTCTG CGCCCAAGCC GTTCTCGGCG TGACCATCAT CTCCAAGTCG 
0061 GAGTGGGGCG GCCGTTCCGC CACGAGCAAG ACCT-CGCTG GCCAACTACC TGAGCTACGC 
0121 CGTGATCCAC CACACCGCTG GAAACTACTG CAGCACCAAG GCCGCCTGCA TCACACAGCT 
0181 GCAGAACATC CAGGCCTACC ACATGGACTC CCTGGGCTGG GCCGATATCG GCTACAACTT 
0241 CCTGATCGGC GGAGACGGCA ACGTGTACGA GGGTCGCGGC TGGAACGTTA TGGGTGCTCA 
0301 CGCCACTAAC TGGAACTCCA AGTCTATCGG CATCTCCTTC CTGGGCAACT ACAATACCAA 
0361 CACCCTCACC TCTGCTCAGA TCACCGCTGC CAAGGGTCTG CTCTCCGATG CGGTCAGTCG 
0421 CGGCCAGATC GTTTCCGGAT ACATCCTGTA CGGACATCGG CAGGTCGGCT CCACCGAGTG 
0481 CCCCGGCACC AACATCTGGA A 
 Assemble Data

14745R-2.IR_full        1   TTCTGGCCGTACTCTTCTGCGCCCAAGCCGTTCTCGGCGTGACCATCATCTCCAAGTCG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14745R-2.in silico      1   TTCTGGCCGTACTCTTCTGCGCCCAAGCCGTTCTCGGCGTGACCATCATCTCCAAGTCG 59


14745R-2.IR_full       61  GAGTGGGGCGGCCGTTCCNCCACGAGCAAGACCTNCGCTGGCCAACTACCTGAGCTACGC 119
                           |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||
14745R-2.in silico     61  GAGTGGGGCGGCCGTTCCGCCACGAGCAAGACCT-CGCTGGCCAACTACCTGAGCTACGC 119


14745R-2.IR_full       121 CGTGATCCACCACACCGCTGGAAACTACTGCAGCACCAAGGCCGCCTGCATCACACAGCT 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14745R-2.in silico     121 CGTGATCCACCACACCGCTGGAAACTACTGCAGCACCAAGGCCGCCTGCATCACACAGCT 179


14745R-2.IR_full       181 GCAGAACATCCAGGCCTACCACATGGACTCCCTGGGCTGGGCCGATATCGGCTACAACTT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14745R-2.in silico     181 GCAGAACATCCAGGCCTACCACATGGACTCCCTGGGCTGGGCCGATATCGGCTACAACTT 239


14745R-2.IR_full       241 CCTGATCGGCGGAGACGGCAACGTGTACGAGGGTCGCGGCTGGAACGTTATGGGTGCTCA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14745R-2.in silico     241 CCTGATCGGCGGAGACGGCAACGTGTACGAGGGTCGCGGCTGGAACGTTATGGGTGCTCA 299


14745R-2.IR_full       301 CGCCACTAACTGGAACTCCAAGTCTATCGGCATCTCCTTCCTGGGCAACTACAATACCAA 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14745R-2.in silico     301 CGCCACTAACTGGAACTCCAAGTCTATCGGCATCTCCTTCCTGGGCAACTACAATACCAA 359


14745R-2.IR_full       361 CACCCTCACCTCTGCTCAGATCACCGCTGCCAAGGGTCTGCTCTCCGATGCGGTCAGTCG 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14745R-2.in silico     361 CACCCTCACCTCTGCTCAGATCACCGCTGCCAAGGGTCTGCTCTCCGATGCGGTCAGTCG 419


14745R-2.IR_full       421 CGGCCAGATCGTTTCCGGATACATCCTGTANGGACATCGGCAGGTCGGCTCCACCGAGTN 479
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| 
14745R-2.in silico     421 CGGCCAGATCGTTTCCGGATACATCCTGTACGGACATCGGCAGGTCGGCTCCACCGAGTG 479


14745R-2.IR_full       481 CCCCGGCACCAACATCTGGAA 500
                           |||||||||||||||||||||
14745R-2.in silico     481 CCCCGGCACCAACATCTGGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136566.1  CG14745-RA (PGRP-SC2), mRNA 
7.46   36  29  84  39  NM_136563.1  CG14746-RA (PGRP-SC1a), mRNA 
7.46   36  23  84  45  NM_136565.1  CG8577-RA (PGRP-SC1b), mRNA 
0   14  NM_132499.2  CG11709-RA (PGRP-SA), mRNA 
0   NM_140660.1  CG9681-RA (PGRP-SB1), mRNA 
0   NM_141550.2  CG9716-RA (Cyp313b1), mRNA 
0   NM_140072.1  CG12525-RA (CG12525), mRNA 
0   NM_138037.1  CG10339-RA (CG10339), mRNA 
0   NM_057852.2  CG9976-RA (Lectin-galC1), mRNA 
0   NM_132915.1  CG15865-RA (CG15865), mRNA 
0   NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
0   NM_164448.1  CG4244-RA, transcript variant A (Su(dx)), mRNA 
0   NM_164449.1  CG4244-RC, transcript variant C (Su(dx)), mRNA 
0   NM_143704.1  CG2916-RB, transcript variant B (Sep5), mRNA 
0   NM_165578.1  CG2916-RA, transcript variant A (Sep5), mRNA 
0   NM_135029.2  CG3036-RA (CG3036), mRNA 
0   NM_164674.1  CG31643-RA (CG31643), mRNA 
0   NM_141101.1  CG14566-RA (CG14566), mRNA 
0   NM_079111.2  CG2827-RA (Tal), mRNA 
0   NM_136409.1  CG17002-RB (CG17002), mRNA 
0   NM_167455.1  CG12708-RA (CG12708), mRNA 
0   NM_143815.2  CG3953-RA (l(3)IX-14), mRNA 
0   NM_136712.2  CG30011-RC, transcript variant C (gem), mRNA 
0   NM_165750.2  CG30011-RA, transcript variant A (gem), mRNA 
0   NM_140659.1  CG9697-RA (PGRP-SB2), mRNA 
0   NM_141046.3  CG7605-RA (Rab26), mRNA 
0   15  NM_132850.2  CG8995-RA (PGRP-LE), mRNA 
0   NM_140041.2  CG4432-RB, transcript variant B (PGRP-LC), mRNA 
0   NM_137510.2  CG30122-RB (CG30122), mRNA 
0   NM_137192.1  CG12958-RA (CG12958), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.