National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14743R-1 
 Symbol CG14743  Full Name CG14743 
 CG No CG14743  Old CG No CG14743 
 Synonyms CG14743 
 Accession No (Link to NCBI) NM_136564.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGTTGCGAGATGGCCACAAA 
 Primer Seq. 3'
aatctagaggtaccTTATCCATGGCGCTAGAGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 tCGTNTGCGA GATGGCCACA AAAATCGACG ACTGCAAATA TATCACCAAC TTCTTCAACT 
0061 ACTATGTTAT GATGTACTGC TCCTTCAAGA TCGACAATAA AATCACCGAA ATAGTGGTGA 
0121 TGCTCTTGTT TGCACTAATC TACTGCTTCT TCCTTTGCAT CCTCTACGAG GGCGTCAACA 
0181 GCTACTTTGC ACCAACACTC AAGATCGCTG CTCTCAAAAT GAGGATCAAC GAGTACATGG 
0241 CGGGCGTAGT GCTCGTGGGC GTGGCCAACT CCACACCCGA TCTCCTGGTC AACCTGTCGC 
0301 CAGTCAGGAT GGAGGGTCTC ACCTTCAACA TAGCCATGGC CAATGCCCTA ACGATAATTT 
0361 GCTTGAGCGG AGGAGCGGTG TGCTTCATTC GGCCCTTTAG GATGAATGGT CACAGTATCT 
0421 TCCGGGATCT ATTGTTCCTC CTGCTCATCA TCGAGCTGGT GAGATTCTTC ATGAATGATA 
0481 CTgNTCTAGC GCCATGGATA A 
 in silico PCR Fragment
0001 TCGT-TGCGA GATGGCCACA AAAATCGACG ACTGCAAATA TATCACCAAC TTCTTCAACT 
0061 ACTATGTTAT GATGTACTGC TCCTTCAAGA TCGACAATAA AATCACCGAA ATAGTGGTGA 
0121 TGCTCTTGTT TGCACTAATC TACTGCTTCT TCCTTTGCAT CCTCTATGAG GGCGTCAACA 
0181 GCTACTTTGC ACCAACACTC AAGATCGCTG CTCTCAAAAT GAGGATCAAC GAGTACATGG 
0241 CGGGCGTAGT GCTCGTGGGC GTGGCCAACT CCACACCCGA TCTCCTGGTC AACCTGTCGC 
0301 CAGTCAGGAT GGAGGGTCTC ACCTTCAACA TAGCCATGGC CAATGCCCTA ACGATAATTT 
0361 GCTTGAGCGG AGGAGCGGTG TGCTTCATTC GGCCCTTTAG GATGAATGGT CACAGTATCT 
0421 TCCGGGATCT ATTGTTCCTC CTGCTCATCA TCGAGCTGGT GAGATTCTTC ATGAATGATA 
0481 CTGCTCTAGC GCCATGGATA A 
 Assemble Data

14743R-1.IR_full       1   TCGTNTGCGAGATGGCCACAAAAATCGACGACTGCAAATATATCACCAACTTCTTCAACT 60
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
14743R-1.in silico     1   TCGT-TGCGAGATGGCCACAAAAATCGACGACTGCAAATATATCACCAACTTCTTCAACT 60


14743R-1.IR_full       61  ACTATGTTATGATGTACTGCTCCTTCAAGATCGACAATAAAATCACCGAAATAGTGGTGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14743R-1.in silico     61  ACTATGTTATGATGTACTGCTCCTTCAAGATCGACAATAAAATCACCGAAATAGTGGTGA 120


14743R-1.IR_full       121 TGCTCTTGTTTGCACTAATCTACTGCTTCTTCCTTTGCATCCTCTACGAGGGCGTCAACA 180
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
14743R-1.in silico     121 TGCTCTTGTTTGCACTAATCTACTGCTTCTTCCTTTGCATCCTCTATGAGGGCGTCAACA 180


14743R-1.IR_full       181 GCTACTTTGCACCAACACTCAAGATCGCTGCTCTCAAAATGAGGATCAACGAGTACATGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14743R-1.in silico     181 GCTACTTTGCACCAACACTCAAGATCGCTGCTCTCAAAATGAGGATCAACGAGTACATGG 240


14743R-1.IR_full       241 CGGGCGTAGTGCTCGTGGGCGTGGCCAACTCCACACCCGATCTCCTGGTCAACCTGTCGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14743R-1.in silico     241 CGGGCGTAGTGCTCGTGGGCGTGGCCAACTCCACACCCGATCTCCTGGTCAACCTGTCGC 300


14743R-1.IR_full       301 CAGTCAGGATGGAGGGTCTCACCTTCAACATAGCCATGGCCAATGCCCTAACGATAATTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14743R-1.in silico     301 CAGTCAGGATGGAGGGTCTCACCTTCAACATAGCCATGGCCAATGCCCTAACGATAATTT 360


14743R-1.IR_full       361 GCTTGAGCGGAGGAGCGGTGTGCTTCATTCGGCCCTTTAGGATGAATGGTCACAGTATCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14743R-1.in silico     361 GCTTGAGCGGAGGAGCGGTGTGCTTCATTCGGCCCTTTAGGATGAATGGTCACAGTATCT 420


14743R-1.IR_full       421 TCCGGGATCTATTGTTCCTCCTGCTCATCATCGAGCTGGTGAGATTCTTCATGAATGATA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14743R-1.in silico     421 TCCGGGATCTATTGTTCCTCCTGCTCATCATCGAGCTGGTGAGATTCTTCATGAATGATA 480


14743R-1.IR_full       481 CTGNTCTAGCGCCATGGATAA 501
                           ||| |||||||||||||||||
14743R-1.in silico     481 CTGCTCTAGCGCCATGGATAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136564.1  CG14743-RA (CG14743), mRNA 
0.2   NM_139639.1  CG11342-RA (CG11342), mRNA 
0   NM_168692.2  CG32170-RA (CG32170), mRNA 
0   NM_142210.1  CG6118-RA (CG6118), mRNA 
0   NM_142786.1  CG13847-RA (CG13847), mRNA 
0   NM_169716.1  CG14880-RB, transcript variant B (CG14880), mRNA 
0   NM_142281.2  CG14880-RA, transcript variant A (CG14880), mRNA 
0   NR_001327.1  CG14880-RA, transcript variant A (CG14880), mRNA, mRNA 
0   NM_057907.2  CG4007-RA (Nrk), mRNA 
0   NM_137439.1  CG5767-RA (CG5767), mRNA 
0   NM_165535.1  CG2146-RC, transcript variant C (didum), mRNA 
0   NM_165536.1  CG2146-RB, transcript variant B (didum), mRNA 
0   NM_057838.3  CG2146-RA, transcript variant A (didum), mRNA 
0   NM_001042862.1  CG7337-RC, transcript variant C (CG7337), mRNA 
0   NM_057243.3  CG3228-RA (kz), mRNA 
0   NM_142332.1  CG18213-RA (CG18213), mRNA 
0   NM_139589.1  CG14985-RA (CG14985), mRNA 
0   NM_141809.1  CG6715-RA (KP78a), mRNA 
0   NM_175992.1  CG32986-RA (CG32986), mRNA 
0   NM_136053.2  CG10338-RA (CG10338), mRNA 
0   NM_142773.1  CG7069-RA (CG7069), mRNA 
0   NM_134985.2  CG3054-RB, transcript variant B (l(2)k05819), mRNA 
0   NM_164582.1  CG3054-RA, transcript variant A (l(2)k05819), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_167029.1  CG10706-RC, transcript variant C (SK), mRNA 
0   NM_167032.1  CG10706-RB, transcript variant B (SK), mRNA 
0   NM_167031.1  CG10706-RA, transcript variant A (SK), mRNA 
0   NM_206631.1  CG10706-RF, transcript variant F (SK), mRNA 
0   NM_078851.2  CG4192-RA (kek3), mRNA 
0   NM_166313.1  CG30329-RA (Vha100-3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.