National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14732R-2 
 Symbol CG31211  Full Name CG31211 
 CG No CG31211  Old CG No CG14732 
 Synonyms CG14732, CG18546, cDNA, anon-WO03070958.3, CG31211 
 Accession No (Link to NCBI) NM_141874.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||| |||    ||||||||   |||  |||||||  ||||||   ||||||| silico     1   GGCTACAACAA-GCA----TGCCCACG---TCC--ATGGACT--TGGACA---ACATGGC 60

                           |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     61  CATGGGCACAACCATA-ATCACAATCAGTTCCTGGCGCAGCCCCCACCACCCCCCACACA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTTTTCACTGCCCTCCGGGGGCGGTCAGGGCATGGTGACGCCCATGGTAGCCGCCGGCCT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCGCTCGCCATGCAGGGTGGCGTTGGCATCGATTGGGCGCAGCTCGCCCAGCAATGGAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCACATGCGGGACGCTACTCCGGTGCCCATGCCCCTGGCCCCTCCGCCGCCCATCATCAG 300

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     301 CAATTTGCGAGAATACCACCAGCAGACGCTAGCAAT-GCCGGTGCCCAGTGTGGTCAGGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGGGATTTCCGCAACTAGAGGAGCACGGCGAGGCGGATATGGACATGGACGATGAGAATG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCGGGGACATAGCACTGAGACACCCCCACCGCCAGCACCTTTGGTTACGCAATCCCAAT 480

                           ||||||||||||||||||||||||||||||||||||| silico     481 GGCTGGCGGGCACCGAAGTGGCTGGTCAGATCCCAGA 517

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
100   482  NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
100   482  NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0.41   NM_141951.1  CG5608-RA (CG5608), mRNA 
0   NM_168049.1  CG32257-RA (Gr64b), mRNA 
0   NM_143313.1  CG5639-RA (CG5639), mRNA 
0   10  NM_142397.1  CG14318-RA (CG14318), mRNA 
0   NM_143446.2  CG1907-RA (CG1907), mRNA 
0   NM_132416.1  CG2111-RA (CG2111), mRNA 
0   NM_140048.2  CG4080-RA (CG4080), mRNA 
0   NM_079741.2  CG10210-RA (tst), mRNA 
0   18  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_131926.1  CG15570-RA (CG15570), mRNA 
0   NM_136237.2  CG9265-RA (CG9265), mRNA 
0   11  NM_135615.2  CG6700-RA (CG6700), mRNA 
0   NM_138261.2  CG9166-RA (312), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_136634.2  CG1975-RA (Rep2), mRNA 
0   NM_142862.1  CG17111-RA (CG17111), mRNA 
0   12  NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_136844.3  CG9005-RA (CG9005), mRNA 
0   NM_135618.1  CG17137-RA (Porin2), mRNA 
0   NM_078772.2  CG13772-RA (neuroligin), mRNA 
0   NM_166342.1  CG11961-RA, transcript variant A (CG11961), mRNA 
0   NM_079281.3  CG12526-RA (Or67a), mRNA 
0   17  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0   17  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0   17  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0   NM_169940.1  CG5685-RB, transcript variant B (Calx), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.