National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14732R-1 
 Symbol CG31211  Full Name CG31211 
 CG No CG31211  Old CG No CG14732 
 Synonyms CG14732, CG18546, cDNA, anon-WO03070958.3, CG31211 
 Accession No (Link to NCBI) NM_141874.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCTACAACAAGCATGCCCAC 
 Primer Seq. 3'
aatctagaggtaccTCTGGGATCTGACCAGCCACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCTACAACA ATGCACCTTT GCCCACGCAA TCCCAATGGA CTGGTGGACA CCGACATGGC 
0061 CATGGGCACA ACCATAGATC ACAATCAGTT CCTGGCGCAG CCCCCACCAC CCCCCACACA 
0121 TTTTTCACTG CCCTCCGGGG GCGGTCAGGG CATGGTGACG CCCATGGTAG CCGCCGGCCT 
0181 GCCGCTCGCC ATGCAGGGTG GCGTTGGCAT CGATTGGGCG CAGCTCGCCC AGCAATGGAT 
0241 CCACATGCGG GACGCTACTC CGGTGCCCAT GCCCCTGGCC CCTCCGCCGC CCATCATCAG 
0301 CAATTTGCGA GAATACCACC AGCAGACGCT AGCAATNGCC GGTGCCCAGT GTGGTCAGGG 
0361 CGGGATTTCC GCAACTAGAG GAGCACGGCG AGGCGGATAT GGACATGGAC GATGAGAATG 
0421 ATCGGGGACA TAGCACTGAG ACACCCCCAC CGCCAGCACC TTTGGTTACG CAATCCCAAT 
0481 GGCTGGCGGG CACCGAAGTG GCTGGTCAGA TCCCAGA 
 in silico PCR Fragment
0001 GGCTACAACA A-GCA----T GCCCACG--- TCC--ATGGA CT--TGGACA ---ACATGGC 
0061 CATGGGCACA ACCATA-ATC ACAATCAGTT CCTGGCGCAG CCCCCACCAC CCCCCACACA 
0121 TTTTTCACTG CCCTCCGGGG GCGGTCAGGG CATGGTGACG CCCATGGTAG CCGCCGGCCT 
0181 GCCGCTCGCC ATGCAGGGTG GCGTTGGCAT CGATTGGGCG CAGCTCGCCC AGCAATGGAT 
0241 CCACATGCGG GACGCTACTC CGGTGCCCAT GCCCCTGGCC CCTCCGCCGC CCATCATCAG 
0301 CAATTTGCGA GAATACCACC AGCAGACGCT AGCAAT-GCC GGTGCCCAGT GTGGTCAGGG 
0361 CGGGATTTCC GCAACTAGAG GAGCACGGCG AGGCGGATAT GGACATGGAC GATGAGAATG 
0421 ATCGGGGACA TAGCACTGAG ACACCCCCAC CGCCAGCACC TTTGGTTACG CAATCCCAAT 
0481 GGCTGGCGGG CACCGAAGTG GCTGGTCAGA TCCCAGA 
 Assemble Data

14732R-1.IR_full       1   GGCTACAACAATGCACCTTTGCCCACGCAATCCCAATGGACTGGTGGACACCGACATGGC 60
                           ||||||||||| |||    ||||||||   |||  |||||||  ||||||   |||||||
14732R-1.in silico     1   GGCTACAACAA-GCA----TGCCCACG---TCC--ATGGACT--TGGACA---ACATGGC 60


14732R-1.IR_full       61  CATGGGCACAACCATAGATCACAATCAGTTCCTGGCGCAGCCCCCACCACCCCCCACACA 120
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
14732R-1.in silico     61  CATGGGCACAACCATA-ATCACAATCAGTTCCTGGCGCAGCCCCCACCACCCCCCACACA 120


14732R-1.IR_full       121 TTTTTCACTGCCCTCCGGGGGCGGTCAGGGCATGGTGACGCCCATGGTAGCCGCCGGCCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14732R-1.in silico     121 TTTTTCACTGCCCTCCGGGGGCGGTCAGGGCATGGTGACGCCCATGGTAGCCGCCGGCCT 180


14732R-1.IR_full       181 GCCGCTCGCCATGCAGGGTGGCGTTGGCATCGATTGGGCGCAGCTCGCCCAGCAATGGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14732R-1.in silico     181 GCCGCTCGCCATGCAGGGTGGCGTTGGCATCGATTGGGCGCAGCTCGCCCAGCAATGGAT 240


14732R-1.IR_full       241 CCACATGCGGGACGCTACTCCGGTGCCCATGCCCCTGGCCCCTCCGCCGCCCATCATCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14732R-1.in silico     241 CCACATGCGGGACGCTACTCCGGTGCCCATGCCCCTGGCCCCTCCGCCGCCCATCATCAG 300


14732R-1.IR_full       301 CAATTTGCGAGAATACCACCAGCAGACGCTAGCAATNGCCGGTGCCCAGTGTGGTCAGGG 360
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
14732R-1.in silico     301 CAATTTGCGAGAATACCACCAGCAGACGCTAGCAAT-GCCGGTGCCCAGTGTGGTCAGGG 360


14732R-1.IR_full       361 CGGGATTTCCGCAACTAGAGGAGCACGGCGAGGCGGATATGGACATGGACGATGAGAATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14732R-1.in silico     361 CGGGATTTCCGCAACTAGAGGAGCACGGCGAGGCGGATATGGACATGGACGATGAGAATG 420


14732R-1.IR_full       421 ATCGGGGACATAGCACTGAGACACCCCCACCGCCAGCACCTTTGGTTACGCAATCCCAAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14732R-1.in silico     421 ATCGGGGACATAGCACTGAGACACCCCCACCGCCAGCACCTTTGGTTACGCAATCCCAAT 480


14732R-1.IR_full       481 GGCTGGCGGGCACCGAAGTGGCTGGTCAGATCCCAGA 517
                           |||||||||||||||||||||||||||||||||||||
14732R-1.in silico     481 GGCTGGCGGGCACCGAAGTGGCTGGTCAGATCCCAGA 517

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
100   482  NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
100   482  NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0.41   NM_141951.1  CG5608-RA (CG5608), mRNA 
0   NM_168049.1  CG32257-RA (Gr64b), mRNA 
0   NM_143313.1  CG5639-RA (CG5639), mRNA 
0   10  NM_142397.1  CG14318-RA (CG14318), mRNA 
0   NM_143446.2  CG1907-RA (CG1907), mRNA 
0   NM_132416.1  CG2111-RA (CG2111), mRNA 
0   NM_140048.2  CG4080-RA (CG4080), mRNA 
0   NM_079741.2  CG10210-RA (tst), mRNA 
0   18  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_131926.1  CG15570-RA (CG15570), mRNA 
0   NM_136237.2  CG9265-RA (CG9265), mRNA 
0   11  NM_135615.2  CG6700-RA (CG6700), mRNA 
0   NM_138261.2  CG9166-RA (312), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_136634.2  CG1975-RA (Rep2), mRNA 
0   NM_142862.1  CG17111-RA (CG17111), mRNA 
0   12  NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_136844.3  CG9005-RA (CG9005), mRNA 
0   NM_135618.1  CG17137-RA (Porin2), mRNA 
0   NM_078772.2  CG13772-RA (neuroligin), mRNA 
0   NM_166342.1  CG11961-RA, transcript variant A (CG11961), mRNA 
0   NM_079281.3  CG12526-RA (Or67a), mRNA 
0   17  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0   17  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0   17  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0   NM_169940.1  CG5685-RB, transcript variant B (Calx), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.