National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14731R-3 
 Symbol CG14731  Full Name CG14731 
 CG No CG14731  Old CG No CG14731 
 Synonyms CG14731 
 Accession No (Link to NCBI) NM_141873.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGATGTACCACATGACACCGA 
 Primer Seq. 3'
aatctagaggtaccGTTGTAGCCCCATAGTTCAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGATGTACCA CATGACACCG ATGCCCTCAT CTGCGTGCCC TATGATCAAA CTGATGAAGC 
0061 CCCAATCCAT TGACGGAATG AACTACCTGT ACTTGATCGC CAGTGCAAAG GAGCTTTGGA 
0121 AAAAGCTAGG AGTTCGGAGG TTAAGCGATA TCTTTTGCGC CTACAAACGC TTCGTGCGGT 
0181 TTAATGACTT TGTGAATATC TACTTTGAAT CGACATTGTT TCGCTTTAGC AAATTGAGAA 
0241 ATTTCACAAA GGTAGATTCC GGTAATATAA CTCTGCGTGT TTGGTGCTGG ATGGACTATG 
0301 GTCGTCTAGT GTATCACGAT GTCTTTATAT TTCTACCATT CCCAAACCCT CAAAAGGTTA 
0361 ATAATTCAGC GCCAGTGAAA CGTNCTTTCA GTTCTAATAC TGGGTATAGA CTCTATTTCC 
0421 CACATGCATT ACCAGCGATA CTTCAGTCGA GTAAGGGACT TGATAGAAGG TTTGCCACAC 
0481 ACTGAACTAT GGGGCTACAA C 
 in silico PCR Fragment
0001 CGATGTACCA CATGACACCG ATGCCCTCAT CTGCGTGCCC TATGATCAAA CTGATGAAGC 
0061 CCCAATCCAT TGACGGAATG AACTATCTGT ACTTGATCGC CAGTGCAAAG GAGCTTTGGA 
0121 AAAAGCTAGG AGTTCGGAGG TTAAGCGATA TCTTTTGCGC CTACAAACGC TTCGTGCGGT 
0181 TTAATGACTT TGTGAATATC TACTTTGAAT CGACATTGTT TCGCTTTAGC AAATTGAGAA 
0241 ATTTCACAAA GGTAGATTCC GGTAATATAA CTCTGCGTGT TTGGTGCTGG ATGGACTATG 
0301 GTCGTCTAGT GTATCACGAT GTCTTTATAT TTCTACCATT CCCAAACCCT CAAAAGGTTA 
0361 ATAATTCAGC GCCAGTGAAA CGT-CTTTCA GTTCTAATAC TGGGTATAGA CTCTATTTCC 
0421 CACATGCATT ACCAGCGATA CTTCAGTCGA GTAAGGGACT TGATAGAAGG TTTGCCACAC 
0481 ACTGAACTAT GGGGCTACAA C 
 Assemble Data

14731R-3.IR_full       1   CGATGTACCACATGACACCGATGCCCTCATCTGCGTGCCCTATGATCAAACTGATGAAGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14731R-3.in silico     1   CGATGTACCACATGACACCGATGCCCTCATCTGCGTGCCCTATGATCAAACTGATGAAGC 60


14731R-3.IR_full       61  CCCAATCCATTGACGGAATGAACTACCTGTACTTGATCGCCAGTGCAAAGGAGCTTTGGA 120
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
14731R-3.in silico     61  CCCAATCCATTGACGGAATGAACTATCTGTACTTGATCGCCAGTGCAAAGGAGCTTTGGA 120


14731R-3.IR_full       121 AAAAGCTAGGAGTTCGGAGGTTAAGCGATATCTTTTGCGCCTACAAACGCTTCGTGCGGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14731R-3.in silico     121 AAAAGCTAGGAGTTCGGAGGTTAAGCGATATCTTTTGCGCCTACAAACGCTTCGTGCGGT 180


14731R-3.IR_full       181 TTAATGACTTTGTGAATATCTACTTTGAATCGACATTGTTTCGCTTTAGCAAATTGAGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14731R-3.in silico     181 TTAATGACTTTGTGAATATCTACTTTGAATCGACATTGTTTCGCTTTAGCAAATTGAGAA 240


14731R-3.IR_full       241 ATTTCACAAAGGTAGATTCCGGTAATATAACTCTGCGTGTTTGGTGCTGGATGGACTATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14731R-3.in silico     241 ATTTCACAAAGGTAGATTCCGGTAATATAACTCTGCGTGTTTGGTGCTGGATGGACTATG 300


14731R-3.IR_full       301 GTCGTCTAGTGTATCACGATGTCTTTATATTTCTACCATTCCCAAACCCTCAAAAGGTTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14731R-3.in silico     301 GTCGTCTAGTGTATCACGATGTCTTTATATTTCTACCATTCCCAAACCCTCAAAAGGTTA 360


14731R-3.IR_full       361 ATAATTCAGCGCCAGTGAAACGTNCTTTCAGTTCTAATACTGGGTATAGACTCTATTTCC 420
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
14731R-3.in silico     361 ATAATTCAGCGCCAGTGAAACGT-CTTTCAGTTCTAATACTGGGTATAGACTCTATTTCC 420


14731R-3.IR_full       421 CACATGCATTACCAGCGATACTTCAGTCGAGTAAGGGACTTGATAGAAGGTTTGCCACAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14731R-3.in silico     421 CACATGCATTACCAGCGATACTTCAGTCGAGTAAGGGACTTGATAGAAGGTTTGCCACAC 480


14731R-3.IR_full       481 ACTGAACTATGGGGCTACAAC 501
                           |||||||||||||||||||||
14731R-3.in silico     481 ACTGAACTATGGGGCTACAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141873.2  CG14731-RA (CG14731), mRNA 
0   NM_137301.1  CG8178-RA, transcript variant A (Nach), mRNA 
0   NM_206137.1  CG8178-RB, transcript variant B (Nach), mRNA 
0   NM_206136.1  CG8178-RC, transcript variant C (Nach), mRNA 
0   NM_170569.1  CG2261-RB, transcript variant B (CstF-50), mRNA 
0   NM_143626.2  CG2261-RA, transcript variant A (CstF-50), mRNA 
0   NM_141021.1  CG10584-RA (CG10584), mRNA 
0   NM_136280.1  CG11630-RA (CG11630), mRNA 
0   NM_142180.2  CG4285-RA (CG4285), mRNA 
0   NM_166594.1  CG30410-RA (CG30410), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_139651.1  CG11349-RA (CG11349), mRNA 
0   NM_140646.2  CG4229-RA (CG4229), mRNA 
0   NM_001015077.1  CG17469-PA.3 (CG17469), mRNA 
0   NM_001038719.1  CG17469-RA, transcript variant A (Mitf), mRNA 
0   NM_136283.2  CG1428-RA (CG1428), mRNA 
0   NM_170553.1  CG1528-RB, transcript variant B (gammaCop), mRNA 
0   NM_079869.2  CG1528-RA, transcript variant A (gammaCop), mRNA 
0   NM_001014592.1  CG12306-RB, transcript variant B (polo), mRNA 
0   NM_079455.3  CG12306-RA, transcript variant A (polo), mRNA 
0   NM_166032.1  CG8233-RC, transcript variant C (CG8233), mRNA 
0   NM_137083.2  CG8233-RB, transcript variant B (CG8233), mRNA 
0   NM_166031.1  CG8233-RA, transcript variant A (CG8233), mRNA 
0   NM_133133.1  CG7990-RA, transcript variant A (CG7990), mRNA 
0   NM_167640.1  CG7990-RB, transcript variant B (CG7990), mRNA 
0   NM_169060.1  CG7990-RB, transcript variant B (CG7990), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_169061.1  CG7990-RB, transcript variant B (CG7990), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   18  NM_134872.1  CG3123-RA (CG3123), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.