National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14730R-3 
 Symbol CG31368  Full Name CG31368 
 CG No CG31368  Old CG No CG14730 
 Synonyms CG14729, CG14730, CG31368 
 Accession No (Link to NCBI) NM_169439.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTCGCTCACTGATCACGACA 
 Primer Seq. 3'
aatctagaggtaccTTGGCGGATTTCATAGGTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTCGCTCAC TGATCACGAC ATGACCCAGC TGCACTACAA GAAGATCACC TCGCTGCAGC 
0061 GAGCGGTGTT CGCCAAGTTT CCCAGCCTGC GGGTCTTTGC CTTGTCCAAC GTAGCCACGG 
0121 TGGATAACAG GGAGTCGCTG GAGCAGCACT TCGGTGGGTT GGATGGCAAG GGACTCCTTC 
0181 AGATTGCCAC GTTCTTGAAT CTCGTGCCAG AGGAGGTGGT CTCACCCTTG GACTGGCATC 
0241 GGGTAGACGA GCAATTTCTG CGTGAGCTGN CTGATTACGC GACATGAGCG ACGCTGTTCG 
0301 CAGTTGGAGG CGCTAAACGA GATGCCCCTG TATCCCACGG AGCAGATCAT CTGGGACGAG 
0361 AACGTGGTGC CCTCGGAATA TTACTCCGGT GACAGCTGCT TGGCGCTACC CAAACTTAAT 
0421 CTGCAGTTCC TGACTCTCCA CGATTATCTC CTACGCAACT TTAACCTATT CCGCTTGGAA 
0481 TCCACCTATG AAATCCGCCA A 
 in silico PCR Fragment
0001 GTTCGCTCAC TGATCACGAC ATGACCCAGC TGCACTACAA GAAGATCACC TCGCTGCAGC 
0061 GAGCGGTGTT CGCCAAGTTT CCCAGCCTGC GGGTCTTTGC CTTGTCCAAC GTAGCCACGG 
0121 TGGATAACAG GGAGTCGCTG GAGCAGCACT TCGGTGGGTT GGATGGCAAG GGACTCCTTC 
0181 AGATTGCCAC GTTCTTGAAT CTCGTGCCAG AGGAGGTGGT CTCACCCTTG GACTGGCATC 
0241 GGGTAGACGA GCAATTTCTG CGTGAGCTG- CTGATTACGC GACATGAGCG ACGCTGTTCG 
0301 CAGTTGGAGG CGCTAAACGA GATGCCCCTG TATCCCACGG AGCAGATCAT CTGGGACGAG 
0361 AACGTGGTGC CCTCGGAATA TTACTCCGGT GACAGCTGCT TGGCGCTACC CAAACTTAAT 
0421 CTGCAGTTCC TGACTCTCCA CGATTATCTC CTACGCAACT TTAACCTATT CCGCTTGGAA 
0481 TCCACCTATG AAATCCGCCA A 
 Assemble Data

14730R-3.IR_full       1   GTTCGCTCACTGATCACGACATGACCCAGCTGCACTACAAGAAGATCACCTCGCTGCAGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14730R-3.in silico     1   GTTCGCTCACTGATCACGACATGACCCAGCTGCACTACAAGAAGATCACCTCGCTGCAGC 60


14730R-3.IR_full       61  GAGCGGTGTTCGCCAAGTTTCCCAGCCTGCGGGTCTTTGCCTTGTCCAACGTAGCCACGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14730R-3.in silico     61  GAGCGGTGTTCGCCAAGTTTCCCAGCCTGCGGGTCTTTGCCTTGTCCAACGTAGCCACGG 120


14730R-3.IR_full       121 TGGATAACAGGGAGTCGCTGGAGCAGCACTTCGGTGGGTTGGATGGCAAGGGACTCCTTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14730R-3.in silico     121 TGGATAACAGGGAGTCGCTGGAGCAGCACTTCGGTGGGTTGGATGGCAAGGGACTCCTTC 180


14730R-3.IR_full       181 AGATTGCCACGTTCTTGAATCTCGTGCCAGAGGAGGTGGTCTCACCCTTGGACTGGCATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14730R-3.in silico     181 AGATTGCCACGTTCTTGAATCTCGTGCCAGAGGAGGTGGTCTCACCCTTGGACTGGCATC 240


14730R-3.IR_full       241 GGGTAGACGAGCAATTTCTGCGTGAGCTGNCTGATTACGCGACATGAGCGACGCTGTTCG 300
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
14730R-3.in silico     241 GGGTAGACGAGCAATTTCTGCGTGAGCTG-CTGATTACGCGACATGAGCGACGCTGTTCG 300


14730R-3.IR_full       301 CAGTTGGAGGCGCTAAACGAGATGCCCCTGTATCCCACGGAGCAGATCATCTGGGACGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14730R-3.in silico     301 CAGTTGGAGGCGCTAAACGAGATGCCCCTGTATCCCACGGAGCAGATCATCTGGGACGAG 360


14730R-3.IR_full       361 AACGTGGTGCCCTCGGAATATTACTCCGGTGACAGCTGCTTGGCGCTACCCAAACTTAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14730R-3.in silico     361 AACGTGGTGCCCTCGGAATATTACTCCGGTGACAGCTGCTTGGCGCTACCCAAACTTAAT 420


14730R-3.IR_full       421 CTGCAGTTCCTGACTCTCCACGATTATCTCCTACGCAACTTTAACCTATTCCGCTTGGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14730R-3.in silico     421 CTGCAGTTCCTGACTCTCCACGATTATCTCCTACGCAACTTTAACCTATTCCGCTTGGAA 480


14730R-3.IR_full       481 TCCACCTATGAAATCCGCCAA 501
                           |||||||||||||||||||||
14730R-3.in silico     481 TCCACCTATGAAATCCGCCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169439.2  CG31368-RA, transcript variant A (CG31368), mRNA 
100   482  NM_206476.1  CG31368-RB, transcript variant B (CG31368), mRNA 
0   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_144304.1  CG18662-RA (CG18662), mRNA 
0   NM_176271.1  CG2469-RB, transcript variant B (CG2469), mRNA 
0   NM_176270.1  CG2469-RA, transcript variant A (CG2469), mRNA 
0   NM_057678.3  CG31240-RA (repo), mRNA 
0   NM_142221.1  CG18516-RA (CG18516), mRNA 
0   NM_142432.2  CG7985-RA (CG7985), mRNA 
0   NM_135788.2  CG6116-RA (CG6116), mRNA 
0   NM_142600.2  CG4433-RA, transcript variant A (CG4433), mRNA 
0   NM_134876.1  CG18558-RA (CG18558), mRNA 
0   NM_139659.1  CG11357-RA (CG11357), mRNA 
0   NM_132837.1  CG8944-RB, transcript variant B (CG8944), mRNA 
0   NM_167460.1  CG8944-RA, transcript variant A (CG8944), mRNA 
0   NM_166884.2  CG32813-RB, transcript variant B (CG32813), mRNA 
0   NM_166882.1  CG32813-RC, transcript variant C (CG32813), mRNA 
0   NM_130553.2  CG32813-RA, transcript variant A (CG32813), mRNA 
0   NM_166883.1  CG32813-RF, transcript variant F (CG32813), mRNA 
0   NM_166881.1  CG32813-RE, transcript variant E (CG32813), mRNA 
0   NM_166885.1  CG32813-RD, transcript variant D (CG32813), mRNA 
0   NM_170523.2  CG1322-RA, transcript variant A (zfh1), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_057425.2  CG9450-RA (tud), mRNA 
0   NM_057820.3  CG9261-RC, transcript variant C (nrv2), mRNA 
0   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   NM_001014475.1  CG9261-RF, transcript variant F (nrv2), mRNA 
0   NM_164381.1  CG11907-RA, transcript variant A (Ent1), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.