National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1469R-2 
 Symbol Fer2LCH  Full Name Ferritin 2 light chain homologue 
 CG No CG1469  Old CG No CG1469 
 Synonyms CG1469, LCH, 2LCH, l(3)07016, unnamed, l(3)00035, l(3)neo60, l(3)neo63, l(3)s2083, l(3)j2A3, anon-EST:ParkEST264, Fer-H, Fer2LCH 
 Accession No (Link to NCBI) NM_080063.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCGCTCCTTCGAGGACAGCA 
 Primer Seq. 3'
aatctagaggtaccCGTCGAACAGGTAGACGGACA 
 Predicted Fragment Size
372 
 IR fragment full Seq
0001 ACCGCTCCTT CGAGGACAGC ATTGCCCTGA TCAAGCAGGT GACCCGTCGC GGAGGAATCG 
0061 TTGACTTCAA CACCCGCCAC GAGTCTTCCG GCTCCGTGAG CACCAAGCGC GGCACTCTTG 
0121 AGGTCGACGA ACTGCACTCC CTGGCTCTGG CTCTGGACAC CGAGAAGCAG CTGGCCACCG 
0181 GAGCCACTCA NCGTGCACTC CCGTGCCACC CACGCCACCG ACGCCGAGAG GGATCCCGAG 
0241 CTGGCCCACT ACTTCGAGGA GAACTTCCTG GGCAAGCAGG CCGAGAGCGT GCGCAAGCTG 
0301 TCCGGCTATG CCAACGACCT CGCCAAGCTG ATGAAGGTCC CCGACCCATC CCTGTCCGTC 
0361 TACCTGTTCG ACG 
 in silico PCR Fragment
0001 ACCGCTCCTT CGAGGACAGC ATTGCCCTGA TCAAGCAGGT GACCCGTCGC GGAGGAATCG 
0061 TTGACTTCAA CACCCGCCAC GAGTCTTCCG GCTCCGTGAG CACCAAGCGC GGCACTCTTG 
0121 AGGTCGACGA ACTGCACTCC CTGGCTCTGG CTCTGGACAC CGAGAAGCAG CTGGCCACCG 
0181 GAGCCACTCA -CGTGCACTC CCGTGCCACC CACGCCACCG ACGCCGAGAG GGATCCCGAG 
0241 CTGGCCCACT ACTTCGAGGA GAACTTCCTG GGCAAGCAGG CCGAGAGCGT GCGCAAGCTG 
0301 TCCGGCTATG CCAACGACCT CGCCAAGCTG ATGAAGGTCC CCGACCCATC CCTGTCCGTC 
0361 TACCTGTTCG ACG 
 Assemble Data

1469R-2.IR_full       1   ACCGCTCCTTCGAGGACAGCATTGCCCTGATCAAGCAGGTGACCCGTCGCGGAGGAATCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1469R-2.in silico     1   ACCGCTCCTTCGAGGACAGCATTGCCCTGATCAAGCAGGTGACCCGTCGCGGAGGAATCG 60


1469R-2.IR_full       61  TTGACTTCAACACCCGCCACGAGTCTTCCGGCTCCGTGAGCACCAAGCGCGGCACTCTTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1469R-2.in silico     61  TTGACTTCAACACCCGCCACGAGTCTTCCGGCTCCGTGAGCACCAAGCGCGGCACTCTTG 120


1469R-2.IR_full       121 AGGTCGACGAACTGCACTCCCTGGCTCTGGCTCTGGACACCGAGAAGCAGCTGGCCACCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1469R-2.in silico     121 AGGTCGACGAACTGCACTCCCTGGCTCTGGCTCTGGACACCGAGAAGCAGCTGGCCACCG 180


1469R-2.IR_full       181 GAGCCACTCANCGTGCACTCCCGTGCCACCCACGCCACCGACGCCGAGAGGGATCCCGAG 240
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
1469R-2.in silico     181 GAGCCACTCA-CGTGCACTCCCGTGCCACCCACGCCACCGACGCCGAGAGGGATCCCGAG 240


1469R-2.IR_full       241 CTGGCCCACTACTTCGAGGAGAACTTCCTGGGCAAGCAGGCCGAGAGCGTGCGCAAGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1469R-2.in silico     241 CTGGCCCACTACTTCGAGGAGAACTTCCTGGGCAAGCAGGCCGAGAGCGTGCGCAAGCTG 300


1469R-2.IR_full       301 TCCGGCTATGCCAACGACCTCGCCAAGCTGATGAAGGTCCCCGACCCATCCCTGTCCGTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1469R-2.in silico     301 TCCGGCTATGCCAACGACCTCGCCAAGCTGATGAAGGTCCCCGACCCATCCCTGTCCGTC 360


1469R-2.IR_full       361 TACCTGTTCGACG 373
                          |||||||||||||
1469R-2.in silico     361 TACCTGTTCGACG 373

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   354  NM_080063.2  CG1469-RA, transcript variant A (Fer2LCH), mRNA 
100   354  NM_170483.1  CG1469-RB, transcript variant B (Fer2LCH), mRNA 
100   354  NM_170484.1  CG1469-RC, transcript variant C (Fer2LCH), mRNA 
0.56   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   NM_142874.2  CG6747-RA (Ir), mRNA 
0   NM_205888.1  CG4629-RC, transcript variant C (CG4629), mRNA 
0   NM_164404.2  CG4629-RB, transcript variant B (CG4629), mRNA 
0   NM_134720.2  CG4629-RA, transcript variant A (CG4629), mRNA 
0   NM_130709.1  CG14271-RB (Gas8), mRNA 
0   NM_132083.3  CG3815-RA (CG3815), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   NM_001032021.1  CG31043-RC, transcript variant C (gukh), mRNA 
0   NM_169846.1  CG31043-RB, transcript variant B (gukh), mRNA 
0   NM_143379.2  CG1647-RA (CG1647), mRNA 
0   NM_057892.3  CG4258-RA (dbe), mRNA 
0   NM_136202.4  CG31678-RA (CG31678), mRNA 
0   NM_079677.2  CG6027-RA (cdi), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_136849.1  CG30035-RA, transcript variant A (CG30035), mRNA 
0   NM_165845.1  CG30035-RB, transcript variant B (CG30035), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_138106.1  CG3640-RA (CG3640), mRNA 
0   NM_165846.2  CG8234-RB, transcript variant B (CG8234), mRNA 
0   NM_136850.2  CG8234-RA, transcript variant A (CG8234), mRNA 
0   NM_175969.1  CG33113-RF, transcript variant F (Rtnl1), mRNA 
0   NM_138080.2  CG4612-RA (CG4612), mRNA 
0   10  NM_166393.1  CG30143-RA (CG30143), mRNA 
0   NM_001043115.1  CG1066-RC, transcript variant C (Shab), mRNA 
0   NM_079170.2  CG1066-RB, transcript variant B (Shab), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.