National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1463R-1 
 Symbol CG1463  Full Name CG1463 
 CG No CG1463  Old CG No CG1463 
 Synonyms CG1463 
 Accession No (Link to NCBI) NM_132585.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCTGCTACGCATGTCCCAAA 
 Primer Seq. 3'
aatctagaggtaccCGCAGATCCACATACTTGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCNTGNCTAC GCATGTCCCA AATGCGAGGT GAAAACATGC AGCCTGCCCT GCGTCCAGAT 
0061 CCATAAGAAG GAGCTCAACT GCGATGGCCA GCGGGATCGC ACCAAGTTCG TANCCGCTGA 
0121 GCGAGNATGA CCTCGCGNGG AATTCATGAG TGACTACTGC TTCTTGGAGG AGTGCACACG 
0181 CTATGCAGAG AATCGAAAAT CCGATCCGTG CAAGCGATTT ACCCACGACC AAAGGAATCT 
0241 CCCAGTGACT CAACATCGCA TGCGGATGGC AGCCAAGAAG CGTAACATTA ATCTGCGCTT 
0301 GCAACTGGAG AATTTCAGTC GGCACAAGGA GAACACTACG TATCTAAACT GGAAACTGGG 
0361 ACGATTCCAT TGGCGTATAG AGTGGCTGTT TGCAAACATT CCATACGAGG CAAGCCTTCC 
0421 CCGGAATGTA GCGCGATTCG TGGACAAGGA ATGCAATGAG GAGCTCACGC TGCCCGATCT 
0481 GGTAGCCAAG TATGTGGATC TGNG 
 in silico PCR Fragment
0001 GCCTG-CTAC GCATGTCCCA AATGCGAGGT GAAAACATGC AGCCTGCCCT GCGTCCAGAT 
0061 CCATAAGAAG GAGCTCAACT GCGATGGCCA GCGGGATCGC ACCAAGTTCG TA-CCGCTGA 
0121 GCGAG-ATGA CCTCGCG-GG AATTCATGAG TGACTACTGC TTCTTGGAGG AGTGCACACG 
0181 CTATGCAGAG AATCGAAAAT CCGATCCGTG CAAGCGATTT ACCCACGACC AAAGGAATCT 
0241 CCCAGTGACT CAACATCGCA TGCGGATGGC AGCCAAGAAG CGTAACATTA ATCTGCGCTT 
0301 GCAACTGGAG AATTTCAGTC GGCACAAGGA GAACACCACG TATCTAAACT GGAAACTGGG 
0361 ACGATTCCAT TGGCGTATAG AGTGGCTGTT TGCAAATATT CCATACGAGG CAAGCCTTCC 
0421 CCGGAATGTA ACTCGATTTG TGGACAAGGA ATGCAATGAG GAGCTCACGC TGCCCGATCT 
0481 GGTAGCCAAG TATGTGGATC TGCG 
 Assemble Data

1463R-1.IR_full       1   GCNTGNCTACGCATGTCCCAAATGCGAGGTGAAAACATGCAGCCTGCCCTGCGTCCAGAT 60
                          || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||
1463R-1.in silico     1   GCCTG-CTACGCATGTCCCAAATGCGAGGTGAAAACATGCAGCCTGCCCTGCGTCCAGAT 60


1463R-1.IR_full       61  CCATAAGAAGGAGCTCAACTGCGATGGCCAGCGGGATCGCACCAAGTTCGTANCCGCTGA 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
1463R-1.in silico     61  CCATAAGAAGGAGCTCAACTGCGATGGCCAGCGGGATCGCACCAAGTTCGTA-CCGCTGA 120


1463R-1.IR_full       121 GCGAGNATGACCTCGCGNGGAATTCATGAGTGACTACTGCTTCTTGGAGGAGTGCACACG 180
                          ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||
1463R-1.in silico     121 GCGAG-ATGACCTCGCG-GGAATTCATGAGTGACTACTGCTTCTTGGAGGAGTGCACACG 180


1463R-1.IR_full       181 CTATGCAGAGAATCGAAAATCCGATCCGTGCAAGCGATTTACCCACGACCAAAGGAATCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1463R-1.in silico     181 CTATGCAGAGAATCGAAAATCCGATCCGTGCAAGCGATTTACCCACGACCAAAGGAATCT 240


1463R-1.IR_full       241 CCCAGTGACTCAACATCGCATGCGGATGGCAGCCAAGAAGCGTAACATTAATCTGCGCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1463R-1.in silico     241 CCCAGTGACTCAACATCGCATGCGGATGGCAGCCAAGAAGCGTAACATTAATCTGCGCTT 300


1463R-1.IR_full       301 GCAACTGGAGAATTTCAGTCGGCACAAGGAGAACACTACGTATCTAAACTGGAAACTGGG 360
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1463R-1.in silico     301 GCAACTGGAGAATTTCAGTCGGCACAAGGAGAACACCACGTATCTAAACTGGAAACTGGG 360


1463R-1.IR_full       361 ACGATTCCATTGGCGTATAGAGTGGCTGTTTGCAAACATTCCATACGAGGCAAGCCTTCC 420
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1463R-1.in silico     361 ACGATTCCATTGGCGTATAGAGTGGCTGTTTGCAAATATTCCATACGAGGCAAGCCTTCC 420


1463R-1.IR_full       421 CCGGAATGTAGCGCGATTCGTGGACAAGGAATGCAATGAGGAGCTCACGCTGCCCGATCT 480
                          |||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||
1463R-1.in silico     421 CCGGAATGTAACTCGATTTGTGGACAAGGAATGCAATGAGGAGCTCACGCTGCCCGATCT 480


1463R-1.IR_full       481 GGTAGCCAAGTATGTGGATCTGNG 504
                          |||||||||||||||||||||| |
1463R-1.in silico     481 GGTAGCCAAGTATGTGGATCTGCG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132585.2  CG1463-RA (CG1463), mRNA 
0   NM_165913.1  CG8581-RB, transcript variant B (fra), mRNA 
0   NM_078992.2  CG8581-RA, transcript variant A (fra), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_140583.1  CG12272-RA (CG12272), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 
0   NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 
0   NM_137209.2  CG8214-RA (CG8214), mRNA 
0   NM_138759.2  CG9242-RA (bur), mRNA 
0   10  NM_140271.1  CG17826-RA (CG17826), mRNA 
0   NM_057598.3  CG10739-RA (pigeon), mRNA 
0   NM_142932.1  CG12492-RA (CG12492), mRNA 
0   NM_143104.1  CG11856-RA (Nup358), mRNA 
0   NM_132582.1  CG1824-RA (CG1824), mRNA 
0   NM_167574.1  CG32556-RA, transcript variant A (CG32556), mRNA 
0   NM_135573.2  CG7384-RA (CG7384), mRNA 
0   NM_206773.1  CG32556-RB, transcript variant B (CG32556), mRNA 
0   13  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   11  NM_136730.1  CG12905-RA (Obp46a), mRNA 
0   NM_170553.1  CG1528-RB, transcript variant B (gammaCop), mRNA 
0   NM_079869.2  CG1528-RA, transcript variant A (gammaCop), mRNA 
0   NM_078854.1  CG18096-RA (TepI), mRNA 
0   NM_139608.2  CG1333-RB, transcript variant B (Ero1L), mRNA 
0   NM_001038875.1  CG34029-RA (CG34029), mRNA 
0   NM_168066.1  CG1333-RA, transcript variant A (Ero1L), mRNA 
0   NM_165565.1  CG18495-RA, transcript variant A (Prosalpha6), mRNA 
0   NM_080098.2  CG18495-RB, transcript variant B (Prosalpha6), mRNA 
0   NM_165567.1  CG30382-RA (CG30382), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.