National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14568R-3 
 Symbol CG14568  Full Name CG14568 
 CG No CG14568  Old CG No CG14568 
 Synonyms BcDNA:RE21944, CG14568 
 Accession No (Link to NCBI) NM_141098.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCCACAAGTTCATCTGC 
 Primer Seq. 3'
aatctagaggtaccAGAACTGATCCAGAGCGGATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCCACA AGTTCATCTG CTCCCTGCTC CTGATCGCNG CCATGGCTGC CGTTTCTGTT 
0061 GCAGAGCCTA CCAGATTCCG GGGACGATTT TCCCGCCTGC AGTTTGCCCG TCAGGAGCAG 
0121 GCTCCAGGGG ATCAGGCAGT TTCCGGCCGA CCCCGCCGTG GATATTGCAC CTACGCCGGC 
0181 CTCAGCCCCT TATCCGCCAG CAGGAGTGAC ACCGGAGGTG CCCTTCGACC TGCCCACGGA 
0241 GACTGAAGCG CAACCTGATC TTACCTACGG ACCCCCAGAT GAGCCCGACA ACACCTACGG 
0301 CCCTCCCGAT AACACTTACG GACCACCTGC TGAGCCGGAA AACACCTATG GACCGCCGGC 
0361 TGATGGCCCA GTGGACCAGG CCCCTGCTGC CGATCCCGTG CCCGCCGGCT TGATCCAGCC 
0421 TCGTAACGAA CGCCTCCTCA GTCGTCGTCC GACCCCAGAG AAGCTTCGAT CCGCTCAGAT 
0481 TATCCGCTCT GGATCAGTTC T 
 in silico PCR Fragment
0001 ATGGCCCACA AGTTCATCTG CTCCCTGCTC CTGATCGCAG CCATGGCTGC CGTTTCTGTT 
0061 GCAGAGCCTA CCAGATTCCG GGGACGATTT TCCCGCCTGC AGTTTGCCCG TCAGGAGCAG 
0121 GCTCCAGGGG ATCAGGCAG- TTCCGGCCGA CCCCGCCGTG GATATTGCAC CTACGCCGGC 
0181 CTCAGCCCCT TATCCGCCAG CAGGAGTGAC ACCGGAGGTG CCCTTCGACC TGCCCACGGA 
0241 GACTGAAGCG CAACCTGATC TTACCTACGG ACCCCCAGAT GAGCCCGACA ACACCTACGG 
0301 CCCTCCCGAT AACACTTACG GACCACCTGC TGAGCCGGAA AACACCTATG GACCGCCGGC 
0361 TGATGGCCCA GTGGACCAGG CCCCTGCTGC CGATCCCGTG CCCGCCGGCT TGATCCAGCC 
0421 TCGTAACGAA CGCCTCCTCA GTCGTCGTCC GACCCCAGAG AAGCTTCGAT CCGCTCAGAT 
0481 TATCCGCTCT GGATCAGTTC T 
 Assemble Data

14568R-3.IR_full       1   ATGGCCCACAAGTTCATCTGCTCCCTGCTCCTGATCGCNGCCATGGCTGCCGTTTCTGTT 60
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
14568R-3.in silico     1   ATGGCCCACAAGTTCATCTGCTCCCTGCTCCTGATCGCAGCCATGGCTGCCGTTTCTGTT 60


14568R-3.IR_full       61  GCAGAGCCTACCAGATTCCGGGGACGATTTTCCCGCCTGCAGTTTGCCCGTCAGGAGCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14568R-3.in silico     61  GCAGAGCCTACCAGATTCCGGGGACGATTTTCCCGCCTGCAGTTTGCCCGTCAGGAGCAG 120


14568R-3.IR_full       121 GCTCCAGGGGATCAGGCAGTTTCCGGCCGACCCCGCCGTGGATATTGCACCTACGCCGGC 180
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
14568R-3.in silico     121 GCTCCAGGGGATCAGGCAG-TTCCGGCCGACCCCGCCGTGGATATTGCACCTACGCCGGC 180


14568R-3.IR_full       181 CTCAGCCCCTTATCCGCCAGCAGGAGTGACACCGGAGGTGCCCTTCGACCTGCCCACGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14568R-3.in silico     181 CTCAGCCCCTTATCCGCCAGCAGGAGTGACACCGGAGGTGCCCTTCGACCTGCCCACGGA 240


14568R-3.IR_full       241 GACTGAAGCGCAACCTGATCTTACCTACGGACCCCCAGATGAGCCCGACAACACCTACGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14568R-3.in silico     241 GACTGAAGCGCAACCTGATCTTACCTACGGACCCCCAGATGAGCCCGACAACACCTACGG 300


14568R-3.IR_full       301 CCCTCCCGATAACACTTACGGACCACCTGCTGAGCCGGAAAACACCTATGGACCGCCGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14568R-3.in silico     301 CCCTCCCGATAACACTTACGGACCACCTGCTGAGCCGGAAAACACCTATGGACCGCCGGC 360


14568R-3.IR_full       361 TGATGGCCCAGTGGACCAGGCCCCTGCTGCCGATCCCGTGCCCGCCGGCTTGATCCAGCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14568R-3.in silico     361 TGATGGCCCAGTGGACCAGGCCCCTGCTGCCGATCCCGTGCCCGCCGGCTTGATCCAGCC 420


14568R-3.IR_full       421 TCGTAACGAACGCCTCCTCAGTCGTCGTCCGACCCCAGAGAAGCTTCGATCCGCTCAGAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14568R-3.in silico     421 TCGTAACGAACGCCTCCTCAGTCGTCGTCCGACCCCAGAGAAGCTTCGATCCGCTCAGAT 480


14568R-3.IR_full       481 TATCCGCTCTGGATCAGTTCT 501
                           |||||||||||||||||||||
14568R-3.in silico     481 TATCCGCTCTGGATCAGTTCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  18  NM_141098.1  CG14568-RA (CG14568), mRNA 
0   NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_132900.2  CG9947-RA (CG9947), mRNA 
0   NM_139652.1  CG7465-RA (CG7465), mRNA 
0   11  NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   11  NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_078851.2  CG4192-RA (kek3), mRNA 
0   11  36  NM_141097.2  CG14569-RA (CG14569), mRNA 
0   16  NM_132709.1  CG12480-RA (CG12480), mRNA 
0   NM_139547.1  CG12077-RA (CG12077), mRNA 
0   NM_134577.1  CG1529-RA (CG1529), mRNA 
0   NM_136451.1  CG2137-RA (CG2137), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_139460.1  CG9004-RA (CG9004), mRNA 
0   23  NM_141096.2  CG14570-RA (CG14570), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_168630.1  CG32149-RB, transcript variant B (RhoGAP71E), mRNA 
0   NM_140527.2  CG32149-RA, transcript variant A (RhoGAP71E), mRNA 
0   NM_168629.2  CG32149-RC, transcript variant C (RhoGAP71E), mRNA 
0   NM_164670.1  CG9075-RD, transcript variant D (eIF-4a), mRNA 
0   NM_057247.3  CG9075-RC, transcript variant C (eIF-4a), mRNA 
0   NM_164668.1  CG9075-RA, transcript variant A (eIF-4a), mRNA 
0   NM_164669.1  CG9075-RB, transcript variant B (eIF-4a), mRNA 
0   NM_057973.3  CG2864-RA (Parg), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_140401.1  CG10741-RB, transcript variant B (CG10741), mRNA 
0   NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
0   NM_141379.1  CG1157-RA (Osi15), mRNA 
0   NM_133111.1  CG7358-RA (CG7358), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.