National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14568R-2 
 Symbol CG14568  Full Name CG14568 
 CG No CG14568  Old CG No CG14568 
 Synonyms BcDNA:RE21944, CG14568 
 Accession No (Link to NCBI) NM_141098.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     1   ATGGCCCACAAGTTCATCTGCTCCCTGCTCCTGATCGCAGCCATGGCTGCCGTTTCTGTT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCAGAGCCTACCAGATTCCGGGGACGATTTTCCCGCCTGCAGTTTGCCCGTCAGGAGCAG 120

                           ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     121 GCTCCAGGGGATCAGGCAG-TTCCGGCCGACCCCGCCGTGGATATTGCACCTACGCCGGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTCAGCCCCTTATCCGCCAGCAGGAGTGACACCGGAGGTGCCCTTCGACCTGCCCACGGA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GACTGAAGCGCAACCTGATCTTACCTACGGACCCCCAGATGAGCCCGACAACACCTACGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCCTCCCGATAACACTTACGGACCACCTGCTGAGCCGGAAAACACCTATGGACCGCCGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGATGGCCCAGTGGACCAGGCCCCTGCTGCCGATCCCGTGCCCGCCGGCTTGATCCAGCC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCGTAACGAACGCCTCCTCAGTCGTCGTCCGACCCCAGAGAAGCTTCGATCCGCTCAGAT 480

14568R-2.IR_full       481 TATCCGCTCTGGATCAGTTCT 501
                           ||||||||||||||||||||| silico     481 TATCCGCTCTGGATCAGTTCT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  18  NM_141098.1  CG14568-RA (CG14568), mRNA 
0   NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_132900.2  CG9947-RA (CG9947), mRNA 
0   NM_139652.1  CG7465-RA (CG7465), mRNA 
0   11  NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   11  NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_078851.2  CG4192-RA (kek3), mRNA 
0   11  36  NM_141097.2  CG14569-RA (CG14569), mRNA 
0   16  NM_132709.1  CG12480-RA (CG12480), mRNA 
0   NM_139547.1  CG12077-RA (CG12077), mRNA 
0   NM_134577.1  CG1529-RA (CG1529), mRNA 
0   NM_136451.1  CG2137-RA (CG2137), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_139460.1  CG9004-RA (CG9004), mRNA 
0   23  NM_141096.2  CG14570-RA (CG14570), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_168630.1  CG32149-RB, transcript variant B (RhoGAP71E), mRNA 
0   NM_140527.2  CG32149-RA, transcript variant A (RhoGAP71E), mRNA 
0   NM_168629.2  CG32149-RC, transcript variant C (RhoGAP71E), mRNA 
0   NM_164670.1  CG9075-RD, transcript variant D (eIF-4a), mRNA 
0   NM_057247.3  CG9075-RC, transcript variant C (eIF-4a), mRNA 
0   NM_164668.1  CG9075-RA, transcript variant A (eIF-4a), mRNA 
0   NM_164669.1  CG9075-RB, transcript variant B (eIF-4a), mRNA 
0   NM_057973.3  CG2864-RA (Parg), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_140401.1  CG10741-RB, transcript variant B (CG10741), mRNA 
0   NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
0   NM_141379.1  CG1157-RA (Osi15), mRNA 
0   NM_133111.1  CG7358-RA (CG7358), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.