National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14565R-2 
 Symbol CG14565  Full Name CG14565 
 CG No CG14565  Old CG No CG14565 
 Synonyms CG14565 
 Accession No (Link to NCBI) NM_141103.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTTATCCGGGATCAAGAGGG 
 Primer Seq. 3'
aatctagaggtaccTATTGTCGCCGGGCACCTGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGTTATCCGG GATCAAGAGG GGAATGTCAC CACCGCGGAG GCCACAACTT TGGCGGGTCC 
0061 TGCTTTGAGT CGCGACGAGG AGGCCAGCAT ACTGATTGAT CCTGCCCCGG GCACTTTACA 
0121 TGAGGATATC GCCGTAGCGC CAGAGAAAGT CCGGGAAGCT CCTGCTGCTG AGTACAACAC 
0181 CCAAGCGATT CCATGAAATT GAGCGCCTAT CTCGAGGAGC AGGACGACGA GGGGGAGGAC 
0241 AACAAGGCCG AAGTGGAGGT AACCACAACT GAGCAGCCAA AGGAAAGCCG AGGAGCTAAA 
0301 GGTGGACGAG GAGGAGGGCG TCACCCCTGA AAGTTCAACC ACAGAGAGCA GCACAACTGC 
0361 GGCCACTACC AAACTGTTTG CCATCGACgC CAGTTCGGCC GGAGTGGAGT CCCCACCACC 
0421 GAACGTGGCC ATCTCCCTCT CCCAGGACAA TGAGAATGcA ACGCTATCGA TTGcCGAGCA 
0481 GCAGCAGGTG CCCGGCGACA ATA 
 in silico PCR Fragment
0001 GGTTATCCGG GATCAAGAGG GGAATGTCAC CACCGCGGAG GCCACAACTT TGGCGGGTCC 
0061 TGCTTTGAGT CGCGACGAGG AGGCCAGCAT ACTGATTGAT CCTGCCCCGG GCACTTTACA 
0121 TGAGGATAGC GCCGTAGCGC CAGAG-AAGT CCGGGAAGCT CCTGCTGCTG AGTACAACAC 
0181 CCAAGCGACT CCATGAAATT GAGCGCC-AT CTCGAGGAGC AGGACGACGA GGGGGAGGAC 
0241 AACAAGGCCG AAGTGGAGGT AACCACAACT GAGCAGCCAA AGG-AAGCCG AGGAGCTAAA 
0301 GGTGGACGAG GAGGAGGGCG TCACCCCTGA AAGTTCAACC ACAGAGAGCA GCACAACTGC 
0361 GGCCACTACC AAACTGTTTG CCATCGACGC CAGTTCGGCC GGAGTGGAGT CCCCACCACC 
0421 GAACGTGGCC ATCTCCCTCT CCCAGGACAA TGAGAATGCA ACGCTATCGA TTGCCGAGCA 
0481 GCAGCAGGTG CCCGGCGACA ATA 
 Assemble Data

14565R-2.IR_full       1   GGTTATCCGGGATCAAGAGGGGAATGTCACCACCGCGGAGGCCACAACTTTGGCGGGTCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14565R-2.in silico     1   GGTTATCCGGGATCAAGAGGGGAATGTCACCACCGCGGAGGCCACAACTTTGGCGGGTCC 60


14565R-2.IR_full       61  TGCTTTGAGTCGCGACGAGGAGGCCAGCATACTGATTGATCCTGCCCCGGGCACTTTACA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14565R-2.in silico     61  TGCTTTGAGTCGCGACGAGGAGGCCAGCATACTGATTGATCCTGCCCCGGGCACTTTACA 120


14565R-2.IR_full       121 TGAGGATATCGCCGTAGCGCCAGAGAAAGTCCGGGAAGCTCCTGCTGCTGAGTACAACAC 180
                           |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||
14565R-2.in silico     121 TGAGGATAGCGCCGTAGCGCCAGAG-AAGTCCGGGAAGCTCCTGCTGCTGAGTACAACAC 180


14565R-2.IR_full       181 CCAAGCGATTCCATGAAATTGAGCGCCTATCTCGAGGAGCAGGACGACGAGGGGGAGGAC 240
                           |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||
14565R-2.in silico     181 CCAAGCGACTCCATGAAATTGAGCGCC-ATCTCGAGGAGCAGGACGACGAGGGGGAGGAC 240


14565R-2.IR_full       241 AACAAGGCCGAAGTGGAGGTAACCACAACTGAGCAGCCAAAGGAAAGCCGAGGAGCTAAA 300
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
14565R-2.in silico     241 AACAAGGCCGAAGTGGAGGTAACCACAACTGAGCAGCCAAAGG-AAGCCGAGGAGCTAAA 300


14565R-2.IR_full       301 GGTGGACGAGGAGGAGGGCGTCACCCCTGAAAGTTCAACCACAGAGAGCAGCACAACTGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14565R-2.in silico     301 GGTGGACGAGGAGGAGGGCGTCACCCCTGAAAGTTCAACCACAGAGAGCAGCACAACTGC 360


14565R-2.IR_full       361 GGCCACTACCAAACTGTTTGCCATCGACGCCAGTTCGGCCGGAGTGGAGTCCCCACCACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14565R-2.in silico     361 GGCCACTACCAAACTGTTTGCCATCGACGCCAGTTCGGCCGGAGTGGAGTCCCCACCACC 420


14565R-2.IR_full       421 GAACGTGGCCATCTCCCTCTCCCAGGACAATGAGAATGCAACGCTATCGATTGCCGAGCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14565R-2.in silico     421 GAACGTGGCCATCTCCCTCTCCCAGGACAATGAGAATGCAACGCTATCGATTGCCGAGCA 480


14565R-2.IR_full       481 GCAGCAGGTGCCCGGCGACAATA 503
                           |||||||||||||||||||||||
14565R-2.in silico     481 GCAGCAGGTGCCCGGCGACAATA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141103.2  CG14565-RA (CG14565), mRNA 
0.2   NM_078514.2  CG9653-RA (brk), mRNA 
0   11  NM_143372.1  CG9995-RA (htt), mRNA 
0   20  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   NM_140233.1  CG7339-RA (CG7339), mRNA 
0   22  NM_137686.5  CG9313-RA (CG9313), mRNA 
0   NM_079782.2  CG8337-RA (malpha), mRNA 
0   NM_205938.1  CG13401-RB, transcript variant B (U26), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 
0   NM_057389.4  CG1391-RA, transcript variant A (sol), mRNA 
0   NM_206802.1  CG1391-RC, transcript variant C (sol), mRNA 
0   NM_057390.4  CG1391-RB, transcript variant B (sol), mRNA 
0   NM_206801.1  CG1391-RD, transcript variant D (sol), mRNA 
0   59  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   29  NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
0   10  NM_136485.2  CG30377-RA (CG30377), mRNA 
0   NM_079909.2  CG3327-RA, transcript variant A (E23), mRNA 
0   NM_205900.1  CG3327-RC, transcript variant C (E23), mRNA 
0   NM_166393.1  CG30143-RA (CG30143), mRNA 
0   25  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_164744.1  CG4675-RB, transcript variant B (Ndae1), mRNA 
0   NM_078777.2  CG4675-RA, transcript variant A (Ndae1), mRNA 
0   14  NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   14  NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   14  NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   14  NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_078891.2  CG1374-RA, transcript variant A (tsh), mRNA 
0   NM_206021.1  CG1374-RB, transcript variant B (tsh), mRNA 
0   NM_139475.1  CG16986-RA (CG16986), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.