National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14565R-1 
 Symbol CG14565  Full Name CG14565 
 CG No CG14565  Old CG No CG14565 
 Synonyms CG14565 
 Accession No (Link to NCBI) NM_141103.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGTTATCCGGGATCAAGAGGGGAATGTCACCACCGCGGAGGCCACAACTTTGGCGGGTCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGCTTTGAGTCGCGACGAGGAGGCCAGCATACTGATTGATCCTGCCCCGGGCACTTTACA 120

                           |||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| silico     121 TGAGGATAGCGCCGTAGCGCCAGAG-AAGTCCGGGAAGCTCCTGCTGCTGAGTACAACAC 180

                           |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| silico     181 CCAAGCGACTCCATGAAATTGAGCGCC-ATCTCGAGGAGCAGGACGACGAGGGGGAGGAC 240

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     241 AACAAGGCCGAAGTGGAGGTAACCACAACTGAGCAGCCAAAGG-AAGCCGAGGAGCTAAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGTGGACGAGGAGGAGGGCGTCACCCCTGAAAGTTCAACCACAGAGAGCAGCACAACTGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCCACTACCAAACTGTTTGCCATCGACGCCAGTTCGGCCGGAGTGGAGTCCCCACCACC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAACGTGGCCATCTCCCTCTCCCAGGACAATGAGAATGCAACGCTATCGATTGCCGAGCA 480

14565R-1.IR_full       481 GCAGCAGGTGCCCGGCGACAATA 503
                           ||||||||||||||||||||||| silico     481 GCAGCAGGTGCCCGGCGACAATA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141103.2  CG14565-RA (CG14565), mRNA 
0.2   NM_078514.2  CG9653-RA (brk), mRNA 
0   11  NM_143372.1  CG9995-RA (htt), mRNA 
0   20  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   NM_140233.1  CG7339-RA (CG7339), mRNA 
0   22  NM_137686.5  CG9313-RA (CG9313), mRNA 
0   NM_079782.2  CG8337-RA (malpha), mRNA 
0   NM_205938.1  CG13401-RB, transcript variant B (U26), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 
0   NM_057389.4  CG1391-RA, transcript variant A (sol), mRNA 
0   NM_206802.1  CG1391-RC, transcript variant C (sol), mRNA 
0   NM_057390.4  CG1391-RB, transcript variant B (sol), mRNA 
0   NM_206801.1  CG1391-RD, transcript variant D (sol), mRNA 
0   59  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   29  NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
0   10  NM_136485.2  CG30377-RA (CG30377), mRNA 
0   NM_079909.2  CG3327-RA, transcript variant A (E23), mRNA 
0   NM_205900.1  CG3327-RC, transcript variant C (E23), mRNA 
0   NM_166393.1  CG30143-RA (CG30143), mRNA 
0   25  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_164744.1  CG4675-RB, transcript variant B (Ndae1), mRNA 
0   NM_078777.2  CG4675-RA, transcript variant A (Ndae1), mRNA 
0   14  NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   14  NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   14  NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   14  NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_078891.2  CG1374-RA, transcript variant A (tsh), mRNA 
0   NM_206021.1  CG1374-RB, transcript variant B (tsh), mRNA 
0   NM_139475.1  CG16986-RA (CG16986), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.