National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14443R-1 
 Symbol CG14443  Full Name CG14443 
 CG No CG14443  Old CG No CG14443 
 Synonyms cg14443, CG14443 
 Accession No (Link to NCBI) NM_132102.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTCGAGCGCAGCGGATTCAA 
 Primer Seq. 3'
aatctagaggtaccGGCAAATGTTACCCTCTAAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTCGAGCgc aGCGGANTTT CAATGCAACC ATATTACAGC AACTGGAGGA TCAAGGCTAT 
0061 NGATGGGCCC ACGCCCATTC AGGCACAAAC ATGGTCGATT GCCAAGGAGG GCAAAAATAT 
0121 TGTGATGATT TCCGGAAAGG GTACGGGTAA AACATTGGGC TATCTATTGC CGGGCATAAT 
0181 GAAGATGCAC AATCAGCGCG GATTAATGCA GCACAAGAAA GGACCGATTG TCTTGATATT 
0241 GGTGGACTGC CGTGAGGCTG CTGTCATGGT CCAAAGAGAG GTATTGTACT ATACAAATCC 
0301 TCTCGAGCTT AGGACGCATT GCCTCTTGGG CAACAGTCAA TGGCAAGGTC ATGCCGAATG 
0361 CGATCTGCTG GTGGCCTCTG CTGGTCGCCT GCTTCAAATG ATTGATAACA AAAAACATGT 
0421 TGTAGAACTG GAACGCTGCA CATATTTGGT TCTGGACAAT ATTGATCGCA TGATTGATGT 
0481 GGGCTTAGAG GGTAACATTT GCC 
 in silico PCR Fragment
0001 TTTCGAGCGC AGCGGA--TT CAATGCAACC ATATTACAGC AACTGGAGGA TCAAGGCTAT 
0061 -GATGGGCCC ACGCCCATTC AGGCACAAAC ATGGTCGATT GCCAAGGAGG GCAAAAATAT 
0121 TGTGATGATT TCTGGAAAGG GTACGGGTAA AACATTGGGC TATCTATTGC CGGGCATAAT 
0181 GAAGATGCAC AATCAGCGCG GATTAATGCA GCACAAGAAA GGACCGATTG TCTTGATATT 
0241 GGTGGACTGC CGTGAGGCTG CTGTCATGGT CCAAAGAGAG GTATTGTACT ATACAAATCC 
0301 TCTCGAGCTT AGGACGCATT GCCTCTTGGG CAACAGTCAA TGGCAAGGTC ATGCCGAATG 
0361 CGATCTGCTG GTGGCCTCTG CTGGTCGCCT GCTTCAAATG ATTGATAACA AAAAACATGT 
0421 TGTAGAACTG GAACGCTGCA CATATTTGGT TCTGGACAAT ATTGATCGCA TGATTGATGT 
0481 GGGCTTAGAG GGTAACATTT GCC 
 Assemble Data

14443R-1.IR_full       1   TTTCGAGCGCAGCGGANTTTCAATGCAACCATATTACAGCAACTGGAGGATCAAGGCTAT 60
                           ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico     1   TTTCGAGCGCAGCGGA--TTCAATGCAACCATATTACAGCAACTGGAGGATCAAGGCTAT 60


14443R-1.IR_full        61  GATGGGCCCACGCCCATTCAGGCACAAACATGGTCGATTGCCAAGGAGGGCAAAAATAT 119
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico      61  GATGGGCCCACGCCCATTCAGGCACAAACATGGTCGATTGCCAAGGAGGGCAAAAATAT 119


14443R-1.IR_full       121 TGTGATGATTTCCGGAAAGGGTACGGGTAAAACATTGGGCTATCTATTGCCGGGCATAAT 179
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico     121 TGTGATGATTTCTGGAAAGGGTACGGGTAAAACATTGGGCTATCTATTGCCGGGCATAAT 179


14443R-1.IR_full       181 GAAGATGCACAATCAGCGCGGATTAATGCAGCACAAGAAAGGACCGATTGTCTTGATATT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico     181 GAAGATGCACAATCAGCGCGGATTAATGCAGCACAAGAAAGGACCGATTGTCTTGATATT 239


14443R-1.IR_full       241 GGTGGACTGCCGTGAGGCTGCTGTCATGGTCCAAAGAGAGGTATTGTACTATACAAATCC 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico     241 GGTGGACTGCCGTGAGGCTGCTGTCATGGTCCAAAGAGAGGTATTGTACTATACAAATCC 299


14443R-1.IR_full       301 TCTCGAGCTTAGGACGCATTGCCTCTTGGGCAACAGTCAATGGCAAGGTCATGCCGAATG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico     301 TCTCGAGCTTAGGACGCATTGCCTCTTGGGCAACAGTCAATGGCAAGGTCATGCCGAATG 359


14443R-1.IR_full       361 CGATCTGCTGGTGGCCTCTGCTGGTCGCCTGCTTCAAATGATTGATAACAAAAAACATGT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico     361 CGATCTGCTGGTGGCCTCTGCTGGTCGCCTGCTTCAAATGATTGATAACAAAAAACATGT 419


14443R-1.IR_full       421 TGTAGAACTGGAACGCTGCACATATTTGGTTCTGGACAATATTGATCGCATGATTGATGT 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14443R-1.in silico     421 TGTAGAACTGGAACGCTGCACATATTTGGTTCTGGACAATATTGATCGCATGATTGATGT 479


14443R-1.IR_full       481 GGGCTTAGAGGGTAACATTTGCC 502
                           |||||||||||||||||||||||
14443R-1.in silico     481 GGGCTTAGAGGGTAACATTTGCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132102.1  CG14443-RA (CG14443), mRNA 
0   NM_058102.2  CG2086-RA, transcript variant A (drpr), mRNA 
0   NM_137274.2  CG4282-RA (CG4282), mRNA 
0   11  NM_141639.1  CG16779-RA (CG16779), mRNA 
0   NM_079680.2  CG5269-RA (vib), mRNA 
0   NM_142585.1  CG4733-RA (CG4733), mRNA 
0   NM_078937.3  CG2411-RA (ptc), mRNA 
0   NM_135858.2  CG15293-RA (CG15293), mRNA 
0   NM_141116.1  CG7448-RA, transcript variant A (CG7448), mRNA 
0   NM_206424.1  CG7448-RB, transcript variant B (CG7448), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_080170.2  CG11156-RA (mus101), mRNA 
0   NM_135846.2  CG16884-RA (CG16884), mRNA 
0   NM_206217.1  CG3522-RB, transcript variant B (Start1), mRNA 
0   NM_138092.1  CG3522-RA, transcript variant A (Start1), mRNA 
0   NM_141659.2  CG8286-RA (CG8286), mRNA 
0   NM_206204.1  CG30194-RD, transcript variant D (CG30194), mRNA 
0   NM_206203.1  CG30194-RC, transcript variant C (CG30194), mRNA 
0   NM_137905.2  CG30194-RB, transcript variant B (CG30194), mRNA 
0   NM_140654.1  CG13032-RA (CG13032), mRNA 
0   NM_169364.1  CG17136-RD, transcript variant D (Rbp1), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_079583.1  CG17136-RA, transcript variant A (Rbp1), mRNA 
0   NM_169363.1  CG17136-RC, transcript variant C (Rbp1), mRNA 
0   NM_176252.1  CG33150-RA (Gr59f), mRNA 
0   NM_001038732.1  CG12598-RC, transcript variant C (Adar), mRNA 
0   NM_139852.2  CG8591-RA (CTCF), mRNA 
0   10  NM_205912.1  CG11020-RB, transcript variant B (nompC), mRNA 
0   10  NM_078759.2  CG11020-RA, transcript variant A (nompC), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.