National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14443R-1 
 Symbol CG14443  Full Name CG14443 
 CG No CG14443  Old CG No CG14443 
 Synonyms cg14443, CG14443 
 Accession No (Link to NCBI) NM_132102.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| silico     1   TTTCGAGCGCAGCGGA--TTCAATGCAACCATATTACAGCAACTGGAGGATCAAGGCTAT 60

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      61  GATGGGCCCACGCCCATTCAGGCACAAACATGGTCGATTGCCAAGGAGGGCAAAAATAT 119

                           |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGTGATGATTTCTGGAAAGGGTACGGGTAAAACATTGGGCTATCTATTGCCGGGCATAAT 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAAGATGCACAATCAGCGCGGATTAATGCAGCACAAGAAAGGACCGATTGTCTTGATATT 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGTGGACTGCCGTGAGGCTGCTGTCATGGTCCAAAGAGAGGTATTGTACTATACAAATCC 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCTCGAGCTTAGGACGCATTGCCTCTTGGGCAACAGTCAATGGCAAGGTCATGCCGAATG 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGATCTGCTGGTGGCCTCTGCTGGTCGCCTGCTTCAAATGATTGATAACAAAAAACATGT 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTAGAACTGGAACGCTGCACATATTTGGTTCTGGACAATATTGATCGCATGATTGATGT 479

14443R-1.IR_full       481 GGGCTTAGAGGGTAACATTTGCC 502
                           ||||||||||||||||||||||| silico     481 GGGCTTAGAGGGTAACATTTGCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132102.1  CG14443-RA (CG14443), mRNA 
0   NM_058102.2  CG2086-RA, transcript variant A (drpr), mRNA 
0   NM_137274.2  CG4282-RA (CG4282), mRNA 
0   11  NM_141639.1  CG16779-RA (CG16779), mRNA 
0   NM_079680.2  CG5269-RA (vib), mRNA 
0   NM_142585.1  CG4733-RA (CG4733), mRNA 
0   NM_078937.3  CG2411-RA (ptc), mRNA 
0   NM_135858.2  CG15293-RA (CG15293), mRNA 
0   NM_141116.1  CG7448-RA, transcript variant A (CG7448), mRNA 
0   NM_206424.1  CG7448-RB, transcript variant B (CG7448), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_080170.2  CG11156-RA (mus101), mRNA 
0   NM_135846.2  CG16884-RA (CG16884), mRNA 
0   NM_206217.1  CG3522-RB, transcript variant B (Start1), mRNA 
0   NM_138092.1  CG3522-RA, transcript variant A (Start1), mRNA 
0   NM_141659.2  CG8286-RA (CG8286), mRNA 
0   NM_206204.1  CG30194-RD, transcript variant D (CG30194), mRNA 
0   NM_206203.1  CG30194-RC, transcript variant C (CG30194), mRNA 
0   NM_137905.2  CG30194-RB, transcript variant B (CG30194), mRNA 
0   NM_140654.1  CG13032-RA (CG13032), mRNA 
0   NM_169364.1  CG17136-RD, transcript variant D (Rbp1), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_079583.1  CG17136-RA, transcript variant A (Rbp1), mRNA 
0   NM_169363.1  CG17136-RC, transcript variant C (Rbp1), mRNA 
0   NM_176252.1  CG33150-RA (Gr59f), mRNA 
0   NM_001038732.1  CG12598-RC, transcript variant C (Adar), mRNA 
0   NM_139852.2  CG8591-RA (CTCF), mRNA 
0   10  NM_205912.1  CG11020-RB, transcript variant B (nompC), mRNA 
0   10  NM_078759.2  CG11020-RA, transcript variant A (nompC), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.