National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14435R-1 
 Symbol CG14435  Full Name CG14435 
 CG No CG14435  Old CG No CG14435 
 Synonyms CG14435 
 Accession No (Link to NCBI) NM_132131.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCACCGGTCAGGGTTTCAAT 
 Primer Seq. 3'
aatctagaggtaccTTGCACACGGGACACTTGATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCACCGGTC AGGGTTTCAA TCTGCTGCGC ACTTTGCCCG GCCTGCAGGT GTACCACAAC 
0061 CAGAACTCCA CGTCCATCGA TCGCCAGCGG GCGCGGAAGT CTCAGCTCCG TGCCGGATAT 
0121 ACAGCAGCAG GCGCAGCAGC AGCAGCAACA GGGATCGATC ACCTCGTCCG GCAGCAGTCC 
0181 GCATTCGCAT CCGCATGCGG CGCACGGCCA TCCGGCCGTC GGTGTCACCG TATCCGTGTC 
0241 CGGTAATGCG AATGCCAATA GCAACAGCAA CTTCACAGCC GCCGGGAACA ACAATGGATC 
0301 CGCCATGCAG TCCTACATGC AGCAGAGACG CACTCTCGGC GATTCCATAA GGGACATGTC 
0361 AATGACCGGC GGCAGCATCG CCGAGAGCAT CGCCCTGGCC GCTTCCGCCA CGTCCGCCAA 
0421 TGGGATCGGT CGTGTCTACA CGGCCACCTC GCTTCCATCG CACATTTGGT CCTTCAATGG 
0481 TATCAAGTGT CCCGTATGCA A 
 in silico PCR Fragment
0001 ACCACCGGTC AGGGTTTCAA TCTGCTGCGC ACTTTGCCCG GCCTGCAGGT GTACCACAAC 
0061 CAAAACTCCA CGTCCATCGA TCGCCAGCGG GCGCGG-AGT CTCAGCTCCG TGCCGGATAT 
0121 ACAGCAGCAG GCGCAGCAGC AGCAGCAACA GGGATCGATC ACCTCGTCCG GCAGCAGTCC 
0181 GCATTCGCAT CCGCATGCCG CGCACGGCCA TCCGGCCGTC GGTGTCACCG TATCCGTGTC 
0241 CGGTAATGCG AATGCCAATA GCAACAGCAA CTTCACAGCC GCCGGGAACA ACAATGGATC 
0301 CGCCATGCAG TCCTACATGC AGCAGAGACG CACTCTCGGC GATTCCATAA GGGACATGTC 
0361 AATGACCGGC GGCAGCATCG CCGAGAGCAT CGCCCTGGCC GCTTCCGCCA CGTCCGCCAA 
0421 TGGGATCGGT CGTGTCTACA CGGCCACCTC GCTTCCATCG CACATTTGGT CCTTCAATGG 
0481 TATCAAGTGT CCCGTGTGCA A 
 Assemble Data

14435R-1.IR_full       1   ACCACCGGTCAGGGTTTCAATCTGCTGCGCACTTTGCCCGGCCTGCAGGTGTACCACAAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14435R-1.in silico     1   ACCACCGGTCAGGGTTTCAATCTGCTGCGCACTTTGCCCGGCCTGCAGGTGTACCACAAC 60


14435R-1.IR_full       61  CAGAACTCCACGTCCATCGATCGCCAGCGGGCGCGGAAGTCTCAGCTCCGTGCCGGATAT 120
                           || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
14435R-1.in silico     61  CAAAACTCCACGTCCATCGATCGCCAGCGGGCGCGG-AGTCTCAGCTCCGTGCCGGATAT 120


14435R-1.IR_full       121 ACAGCAGCAGGCGCAGCAGCAGCAGCAACAGGGATCGATCACCTCGTCCGGCAGCAGTCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14435R-1.in silico     121 ACAGCAGCAGGCGCAGCAGCAGCAGCAACAGGGATCGATCACCTCGTCCGGCAGCAGTCC 180


14435R-1.IR_full       181 GCATTCGCATCCGCATGCGGCGCACGGCCATCCGGCCGTCGGTGTCACCGTATCCGTGTC 240
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
14435R-1.in silico     181 GCATTCGCATCCGCATGCCGCGCACGGCCATCCGGCCGTCGGTGTCACCGTATCCGTGTC 240


14435R-1.IR_full       241 CGGTAATGCGAATGCCAATAGCAACAGCAACTTCACAGCCGCCGGGAACAACAATGGATC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14435R-1.in silico     241 CGGTAATGCGAATGCCAATAGCAACAGCAACTTCACAGCCGCCGGGAACAACAATGGATC 300


14435R-1.IR_full       301 CGCCATGCAGTCCTACATGCAGCAGAGACGCACTCTCGGCGATTCCATAAGGGACATGTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14435R-1.in silico     301 CGCCATGCAGTCCTACATGCAGCAGAGACGCACTCTCGGCGATTCCATAAGGGACATGTC 360


14435R-1.IR_full       361 AATGACCGGCGGCAGCATCGCCGAGAGCATCGCCCTGGCCGCTTCCGCCACGTCCGCCAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14435R-1.in silico     361 AATGACCGGCGGCAGCATCGCCGAGAGCATCGCCCTGGCCGCTTCCGCCACGTCCGCCAA 420


14435R-1.IR_full       421 TGGGATCGGTCGTGTCTACACGGCCACCTCGCTTCCATCGCACATTTGGTCCTTCAATGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14435R-1.in silico     421 TGGGATCGGTCGTGTCTACACGGCCACCTCGCTTCCATCGCACATTTGGTCCTTCAATGG 480


14435R-1.IR_full       481 TATCAAGTGTCCCGTATGCAA 501
                           ||||||||||||||| |||||
14435R-1.in silico     481 TATCAAGTGTCCCGTGTGCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  34  NM_132131.2  CG14435-RA (CG14435), mRNA 
2.28   11  13  42  232  NM_132004.2  CG4136-RA (CG4136), mRNA 
1.86   21  52  144  NM_142597.2  CG12254-RA (MED25), mRNA 
1.24   65  492  1073  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.24   65  492  1073  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.24   65  492  1073  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.24   17  67  354  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
1.24   17  64  345  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
1.24   27  NM_139839.3  CG32381-RA (unc-13-4A), mRNA 
1.03   13  29  NM_079309.2  CG5654-RA (yps), mRNA 
0.82   23  69  170  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0.82   23  69  170  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0.82   23  66  108  NM_206483.1  CG17233-RB, transcript variant B (CG17233), mRNA, sub-group O CG3143-RB, transcript variant B (foxo), mRNA 
0.82   23  66  108  NM_206482.1  CG17233-RB, transcript variant B (CG17233), mRNA, sub-group O CG3143-RB, transcript variant B (foxo), mRNA, sub-group O CG3143-RC, transcript variant C (foxo), mRNA 
0.82   23  66  108  NM_142073.3  CG17233-RB, transcript variant B (CG17233), mRNA, sub-group O CG3143-RB, transcript variant B (foxo), mRNA, sub-group O CG3143-RC, transcript variant C (foxo), mRNA, sub-group O CG3143-RA, transcript variant A (foxo), mRNA 
0.82   22  57  140  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
0.82   12  65  164  NM_001043134.1  CG7368-RB (CG7368), mRNA 
0.82   33  86  NM_168444.1  CG11799-RB, transcript variant B (Mnf), mRNA 
0.82   33  86  NM_168445.1  CG11799-RC, transcript variant C (Mnf), mRNA 
0.82   33  86  NM_168446.1  CG11799-RD, transcript variant D (Mnf), mRNA 
0.82   33  86  NM_140183.1  CG11799-RE, transcript variant E (Mnf), mRNA 
0.82   33  86  NM_168443.1  CG11799-RA, transcript variant A (Mnf), mRNA 
0.82   25  41  NM_131968.2  CG32772-RA (CG32772), mRNA 
0.62   41  192  480  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0.62   41  192  480  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0.62   24  116  302  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0.62   24  116  302  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0.62   24  116  300  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0.62   21  63  250  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
0.62   21  43  124  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.