National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14434R-3 
 Symbol CG14434  Full Name CG14434 
 CG No CG14434  Old CG No CG14434 
 Synonyms CG14434 
 Accession No (Link to NCBI) NM_132135.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTACTCCGGCGGATCAGCGCA 
 Primer Seq. 3'
aatctagaggtaccCGCCTCCTGGATACCCAGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTACTCCGGC GGATCAGCGC AATGTGGAGG TGAAGGCACG GATTCCGGGT GGATCTGAGG 
0061 GCTTTGAGCA GCGCCTAATC TTGGCCAGAA ACCTGAGCGG CAGCCAGGNA TGCGCAGTTA 
0121 ATCGAGCAGA GGGACGTCTT CTTTGAATCT CCGCTGGGTG GACGGCTTAA ATTGCGCTAC 
0181 TTACAGACGC CATCGCGCTC CCAATTGGTC TACTACGATC GTCCCGATGT GGCCGGTCCC 
0241 AAGCTTTCCA AGTTCAACAA GACGGAGGTG GACGAACCGG AGGTGCTGGA GAAGATCCTG 
0301 AGCCAGTCGA ACGGCGTACT TGGTGTCCTG GCCAAGCGAC GGCACTTGTT CCTTTGCGGA 
0361 CAGACGCGCA TCCACCTGGA CGAGGTAAAG GATCTGGGAT ACTTCATGGA ACTGGAGGTG 
0421 TGCCTGACAG AGGATCAAAc CCTCGAGGAG GGTCAAGCCA TTGCCGAGAA ACTGTCCAGG 
0481 GAACTGGGTA TCCAGGAGGC G 
 in silico PCR Fragment
0001 TTACTCCGGC GGATCAGCGC AATGTGGAGG TGAAGGCACG GATTCCGGGT GGATCTGAGG 
0061 GCTTTGAGCA GCGCCTAATC TTGGCCAGAA ACCTGAGCGG CAGCCAGG-A TGCGCAGTTA 
0121 ATCGAGCAGA GGGACGTCTT CTTTGAATCT CCGCTGGGTG GACGGCTTAA ATTGCGCTAC 
0181 TTACAGACGC CATCGCGCTC CCAATTGGTC TACTACGATC GTCCCGATGT GGCCGGTCCC 
0241 AAGCTTTCCA AGTTCAACAA GACGGAGGTG GACGAACCGG AGGTGCTGGA GAAGATCCTG 
0301 AGCCAGTCGA ACGGCGTACT TGGTGTCCTG GCCAAGCGAC GGCACTTGTT CCTTTGCGGA 
0361 CAGACGCGCA TCCACCTGGA CGAGGTAAAG GATCTGGGAT ACTTCATGGA ACTGGAGGTG 
0421 TGCCTGACAG AGGATCAAAC CCTCGAGGAG GGTCAAGCCA TTGCCGAGAA ACTGTCCAGG 
0481 GAACTGGGTA TCCAGGAGGC G 
 Assemble Data

14434R-3.IR_full       1   TTACTCCGGCGGATCAGCGCAATGTGGAGGTGAAGGCACGGATTCCGGGTGGATCTGAGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14434R-3.in silico     1   TTACTCCGGCGGATCAGCGCAATGTGGAGGTGAAGGCACGGATTCCGGGTGGATCTGAGG 60


14434R-3.IR_full       61  GCTTTGAGCAGCGCCTAATCTTGGCCAGAAACCTGAGCGGCAGCCAGGNATGCGCAGTTA 120
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
14434R-3.in silico     61  GCTTTGAGCAGCGCCTAATCTTGGCCAGAAACCTGAGCGGCAGCCAGG-ATGCGCAGTTA 120


14434R-3.IR_full       121 ATCGAGCAGAGGGACGTCTTCTTTGAATCTCCGCTGGGTGGACGGCTTAAATTGCGCTAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14434R-3.in silico     121 ATCGAGCAGAGGGACGTCTTCTTTGAATCTCCGCTGGGTGGACGGCTTAAATTGCGCTAC 180


14434R-3.IR_full       181 TTACAGACGCCATCGCGCTCCCAATTGGTCTACTACGATCGTCCCGATGTGGCCGGTCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14434R-3.in silico     181 TTACAGACGCCATCGCGCTCCCAATTGGTCTACTACGATCGTCCCGATGTGGCCGGTCCC 240


14434R-3.IR_full       241 AAGCTTTCCAAGTTCAACAAGACGGAGGTGGACGAACCGGAGGTGCTGGAGAAGATCCTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14434R-3.in silico     241 AAGCTTTCCAAGTTCAACAAGACGGAGGTGGACGAACCGGAGGTGCTGGAGAAGATCCTG 300


14434R-3.IR_full       301 AGCCAGTCGAACGGCGTACTTGGTGTCCTGGCCAAGCGACGGCACTTGTTCCTTTGCGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14434R-3.in silico     301 AGCCAGTCGAACGGCGTACTTGGTGTCCTGGCCAAGCGACGGCACTTGTTCCTTTGCGGA 360


14434R-3.IR_full       361 CAGACGCGCATCCACCTGGACGAGGTAAAGGATCTGGGATACTTCATGGAACTGGAGGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14434R-3.in silico     361 CAGACGCGCATCCACCTGGACGAGGTAAAGGATCTGGGATACTTCATGGAACTGGAGGTG 420


14434R-3.IR_full       421 TGCCTGACAGAGGATCAAACCCTCGAGGAGGGTCAAGCCATTGCCGAGAAACTGTCCAGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14434R-3.in silico     421 TGCCTGACAGAGGATCAAACCCTCGAGGAGGGTCAAGCCATTGCCGAGAAACTGTCCAGG 480


14434R-3.IR_full       481 GAACTGGGTATCCAGGAGGCG 501
                           |||||||||||||||||||||
14434R-3.in silico     481 GAACTGGGTATCCAGGAGGCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132135.1  CG14434-RA (CG14434), mRNA 
0   NM_143259.1  CG5521-RA (CG5521), mRNA 
0   NM_141399.1  CG9727-RA (CG9727), mRNA 
0   NM_079780.2  CG8333-RA (HLHmgamma), mRNA 
0   NM_168180.1  CG32392-RA, transcript variant A (CG32392), mRNA 
0   NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0   NM_001015081.1  CG40477-PA.3 (CG40477), partial mRNA 
0   NM_001031860.1  CG33653-RA, transcript variant A (Caps), mRNA 
0   NM_001031858.1  CG33653-RC, transcript variant C (Caps), mRNA 
0   NM_001031859.1  CG33653-RB, transcript variant B (Caps), mRNA 
0   NM_137398.1  CG4954-RA (eIF3-S8), mRNA 
0   NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   NM_165917.1  CG8815-RD, transcript variant D (Sin3A), mRNA 
0   NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_135607.2  CG6495-RA (CG6495), mRNA 
0   NM_137703.1  CG15655-RA (CG15655), mRNA 
0   NM_164896.1  CG31720-RA (CG31720), mRNA 
0   NM_170471.2  CG31030-RA, transcript variant A (CG31030), mRNA 
0   NM_001043310.1  CG31030-RB, transcript variant B (CG31030), mRNA 
0   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_143533.1  CG2218-RA (CG2218), mRNA 
0   11  NM_169380.1  CG4863-RC, transcript variant C (RpL3), mRNA 
0   11  NM_169378.1  CG4863-RB, transcript variant B (RpL3), mRNA 
0   11  NM_169379.1  CG4863-RE, transcript variant E (RpL3), mRNA 
0   11  NM_169377.1  CG4863-RD, transcript variant D (RpL3), mRNA 
0   11  NM_079592.2  CG4863-RA, transcript variant A (RpL3), mRNA 
0   NM_132584.2  CG32654-RC (CG32654), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.