National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14434R-2 
 Symbol CG14434  Full Name CG14434 
 CG No CG14434  Old CG No CG14434 
 Synonyms CG14434 
 Accession No (Link to NCBI) NM_132135.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTACTCCGGCGGATCAGCGCAATGTGGAGGTGAAGGCACGGATTCCGGGTGGATCTGAGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     61  GCTTTGAGCAGCGCCTAATCTTGGCCAGAAACCTGAGCGGCAGCCAGG-ATGCGCAGTTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCGAGCAGAGGGACGTCTTCTTTGAATCTCCGCTGGGTGGACGGCTTAAATTGCGCTAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTACAGACGCCATCGCGCTCCCAATTGGTCTACTACGATCGTCCCGATGTGGCCGGTCCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGCTTTCCAAGTTCAACAAGACGGAGGTGGACGAACCGGAGGTGCTGGAGAAGATCCTG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCCAGTCGAACGGCGTACTTGGTGTCCTGGCCAAGCGACGGCACTTGTTCCTTTGCGGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAGACGCGCATCCACCTGGACGAGGTAAAGGATCTGGGATACTTCATGGAACTGGAGGTG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGCCTGACAGAGGATCAAACCCTCGAGGAGGGTCAAGCCATTGCCGAGAAACTGTCCAGG 480

14434R-2.IR_full       481 GAACTGGGTATCCAGGAGGCG 501
                           ||||||||||||||||||||| silico     481 GAACTGGGTATCCAGGAGGCG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132135.1  CG14434-RA (CG14434), mRNA 
0   NM_143259.1  CG5521-RA (CG5521), mRNA 
0   NM_141399.1  CG9727-RA (CG9727), mRNA 
0   NM_079780.2  CG8333-RA (HLHmgamma), mRNA 
0   NM_168180.1  CG32392-RA, transcript variant A (CG32392), mRNA 
0   NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0   NM_001015081.1  CG40477-PA.3 (CG40477), partial mRNA 
0   NM_001031860.1  CG33653-RA, transcript variant A (Caps), mRNA 
0   NM_001031858.1  CG33653-RC, transcript variant C (Caps), mRNA 
0   NM_001031859.1  CG33653-RB, transcript variant B (Caps), mRNA 
0   NM_137398.1  CG4954-RA (eIF3-S8), mRNA 
0   NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   NM_165917.1  CG8815-RD, transcript variant D (Sin3A), mRNA 
0   NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_135607.2  CG6495-RA (CG6495), mRNA 
0   NM_137703.1  CG15655-RA (CG15655), mRNA 
0   NM_164896.1  CG31720-RA (CG31720), mRNA 
0   NM_170471.2  CG31030-RA, transcript variant A (CG31030), mRNA 
0   NM_001043310.1  CG31030-RB, transcript variant B (CG31030), mRNA 
0   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_143533.1  CG2218-RA (CG2218), mRNA 
0   11  NM_169380.1  CG4863-RC, transcript variant C (RpL3), mRNA 
0   11  NM_169378.1  CG4863-RB, transcript variant B (RpL3), mRNA 
0   11  NM_169379.1  CG4863-RE, transcript variant E (RpL3), mRNA 
0   11  NM_169377.1  CG4863-RD, transcript variant D (RpL3), mRNA 
0   11  NM_079592.2  CG4863-RA, transcript variant A (RpL3), mRNA 
0   NM_132584.2  CG32654-RC (CG32654), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.