National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14384R-3 
 Symbol CG14384  Full Name CG14384 
 CG No CG14384  Old CG No CG14384 
 Synonyms CG14384 
 Accession No (Link to NCBI) NM_141984.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCCCTCAATTGCCCGGTT 
 Primer Seq. 3'
aatctagaggtaccTGCAATCAGAATCTGAGCTGG 
 Predicted Fragment Size
469 
 IR fragment full Seq
0001 ATGTCCCTCA ATTGCCCGGT TCATAATAAG AACTCCAGTG GCTTAAACAT TACCAGGTCC 
0061 GCAACCTCGG ATGACGTCAA GATCGCCATG TGCGCCTGCT TGGAATTGGC CAACTGTCGG 
0121 GCCGAAAACT GTCAGCTGAA GAAGAAACTG ACCGAATATG AGGCCAAGAT CTGCAGTCTC 
0181 GAACAACTGG TGGCCACCAT TGCGGAGGAG CAGAACCAGA TTCGCCAAGA AGTGATCGAG 
0241 TTGCGCAATG AGACTCAGGG TGCAACGATG GAAGCCGCCA ACGAGGTGGA TCCTTTGGAN 
0301 AACTCATTCG TGAACCCGCA AGAGGAAATG GACGATGAGG AAGGATACGA TCCGGATTCA 
0361 GAATCCGAGT ACAATGCTAT CCAGTCCCCC AATCCCTCAA TACATTCTTC GATGGTCTCG 
0421 CTGGTTCGCT CATTGAGTTT TTCATCCACC AGCTCAGATT CTGATTGCA 
 in silico PCR Fragment
0001 ATGTCCCTCA ATTGCCCGGT TCATAATAAG AACTCCAGTG GCTTAAACAT TACCAGGTCC 
0061 GCAACCTCGG ATGACGTCAA GATCGCCATG TGCGCCTGCT TGGAATTGGC CAACTGTCGG 
0121 GCCGAAAACT GTCAGCTGAA GAAGAAACTG ACCGAATATG AGGCCAAGAT CTGCAGTCTC 
0181 GAACAACTGG TGGCCACCAT TGCGGAGGAG CAGAACCAGA TTCGCCAAGA AGTGATCGAG 
0241 TTGCGCAATG AGACTCAGGG TGCAACGATG GAAGCCGCCA ACGAGGTGGA TCCTTTGGAC 
0301 AACTCATTCG TGAACCCGCA AGAGGAAATG GACGATGAGG AAGGATACGA TCCGGATTCA 
0361 GAATCCGAGT ACAATGCTAT CCAGTCCCCC AATCCCTCAA TACATTCTTC GATGGTCTCG 
0421 CTGGTTCGCT CATTGAGTTT TTCATCCACC AGCTCAGATT CTGATTGCA 
 Assemble Data

14384R-3.IR_full       1   ATGTCCCTCAATTGCCCGGTTCATAATAAGAACTCCAGTGGCTTAAACATTACCAGGTCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14384R-3.in silico     1   ATGTCCCTCAATTGCCCGGTTCATAATAAGAACTCCAGTGGCTTAAACATTACCAGGTCC 60


14384R-3.IR_full       61  GCAACCTCGGATGACGTCAAGATCGCCATGTGCGCCTGCTTGGAATTGGCCAACTGTCGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14384R-3.in silico     61  GCAACCTCGGATGACGTCAAGATCGCCATGTGCGCCTGCTTGGAATTGGCCAACTGTCGG 120


14384R-3.IR_full       121 GCCGAAAACTGTCAGCTGAAGAAGAAACTGACCGAATATGAGGCCAAGATCTGCAGTCTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14384R-3.in silico     121 GCCGAAAACTGTCAGCTGAAGAAGAAACTGACCGAATATGAGGCCAAGATCTGCAGTCTC 180


14384R-3.IR_full       181 GAACAACTGGTGGCCACCATTGCGGAGGAGCAGAACCAGATTCGCCAAGAAGTGATCGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14384R-3.in silico     181 GAACAACTGGTGGCCACCATTGCGGAGGAGCAGAACCAGATTCGCCAAGAAGTGATCGAG 240


14384R-3.IR_full       241 TTGCGCAATGAGACTCAGGGTGCAACGATGGAAGCCGCCAACGAGGTGGATCCTTTGGAN 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
14384R-3.in silico     241 TTGCGCAATGAGACTCAGGGTGCAACGATGGAAGCCGCCAACGAGGTGGATCCTTTGGAC 300


14384R-3.IR_full       301 AACTCATTCGTGAACCCGCAAGAGGAAATGGACGATGAGGAAGGATACGATCCGGATTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14384R-3.in silico     301 AACTCATTCGTGAACCCGCAAGAGGAAATGGACGATGAGGAAGGATACGATCCGGATTCA 360


14384R-3.IR_full       361 GAATCCGAGTACAATGCTATCCAGTCCCCCAATCCCTCAATACATTCTTCGATGGTCTCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14384R-3.in silico     361 GAATCCGAGTACAATGCTATCCAGTCCCCCAATCCCTCAATACATTCTTCGATGGTCTCG 420


14384R-3.IR_full       421 CTGGTTCGCTCATTGAGTTTTTCATCCACCAGCTCAGATTCTGATTGCA 469
                           |||||||||||||||||||||||||||||||||||||||||||||||||
14384R-3.in silico     421 CTGGTTCGCTCATTGAGTTTTTCATCCACCAGCTCAGATTCTGATTGCA 469

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   451  NM_141984.1  CG14384-RA (CG14384), mRNA 
0   10  NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_142110.2  CG8461-RA (CG8461), mRNA 
0   NM_135738.2  CG6167-RA, transcript variant A (PICK1), mRNA 
0   NM_165018.1  CG6167-RB, transcript variant B (PICK1), mRNA 
0   NM_137895.1  CG3800-RA (CG3800), mRNA 
0   NM_137609.1  CG11041-RA (CG11041), mRNA 
0   NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 
0   NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 
0   NM_139785.1  CG10163-RA (CG10163), mRNA 
0   NM_132053.1  CG6041-RA (CG6041), mRNA 
0   NM_206105.1  CG17054-RB, transcript variant B (Cap-G), mRNA 
0   NM_136995.2  CG17054-RA, transcript variant A (Cap-G), mRNA 
0   NM_206103.1  CG17054-RD, transcript variant D (Cap-G), mRNA 
0   NM_206104.1  CG17054-RC, transcript variant C (Cap-G), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_141213.2  CG9805-RA, transcript variant A (eIF3-S10), mRNA 
0   NM_168999.2  CG9805-RB, transcript variant B (eIF3-S10), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_169707.1  CG4006-RB, transcript variant B (Akt1), mRNA 
0   NM_169705.1  CG4006-RC, transcript variant C (Akt1), mRNA 
0   NM_169706.1  CG4006-RA, transcript variant A (Akt1), mRNA 
0   NM_136652.2  CG1809-RA (CG1809), mRNA 
0   NM_135248.1  CG13776-RA (CG13776), mRNA 
0   NM_080253.2  CG5067-RA (cic), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   13  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   13  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_080147.2  CG5965-RA (woc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.