National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14384R-2 
 Symbol CG14384  Full Name CG14384 
 CG No CG14384  Old CG No CG14384 
 Synonyms CG14384 
 Accession No (Link to NCBI) NM_141984.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGTCCCTCAATTGCCCGGTTCATAATAAGAACTCCAGTGGCTTAAACATTACCAGGTCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCAACCTCGGATGACGTCAAGATCGCCATGTGCGCCTGCTTGGAATTGGCCAACTGTCGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCGAAAACTGTCAGCTGAAGAAGAAACTGACCGAATATGAGGCCAAGATCTGCAGTCTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAACAACTGGTGGCCACCATTGCGGAGGAGCAGAACCAGATTCGCCAAGAAGTGATCGAG 240

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTGCGCAATGAGACTCAGGGTGCAACGATGGAAGCCGCCAACGAGGTGGATCCTTTGGAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACTCATTCGTGAACCCGCAAGAGGAAATGGACGATGAGGAAGGATACGATCCGGATTCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAATCCGAGTACAATGCTATCCAGTCCCCCAATCCCTCAATACATTCTTCGATGGTCTCG 420

                           ||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTGGTTCGCTCATTGAGTTTTTCATCCACCAGCTCAGATTCTGATTGCA 469

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   451  NM_141984.1  CG14384-RA (CG14384), mRNA 
0   10  NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_142110.2  CG8461-RA (CG8461), mRNA 
0   NM_135738.2  CG6167-RA, transcript variant A (PICK1), mRNA 
0   NM_165018.1  CG6167-RB, transcript variant B (PICK1), mRNA 
0   NM_137895.1  CG3800-RA (CG3800), mRNA 
0   NM_137609.1  CG11041-RA (CG11041), mRNA 
0   NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 
0   NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 
0   NM_139785.1  CG10163-RA (CG10163), mRNA 
0   NM_132053.1  CG6041-RA (CG6041), mRNA 
0   NM_206105.1  CG17054-RB, transcript variant B (Cap-G), mRNA 
0   NM_136995.2  CG17054-RA, transcript variant A (Cap-G), mRNA 
0   NM_206103.1  CG17054-RD, transcript variant D (Cap-G), mRNA 
0   NM_206104.1  CG17054-RC, transcript variant C (Cap-G), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_141213.2  CG9805-RA, transcript variant A (eIF3-S10), mRNA 
0   NM_168999.2  CG9805-RB, transcript variant B (eIF3-S10), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_169707.1  CG4006-RB, transcript variant B (Akt1), mRNA 
0   NM_169705.1  CG4006-RC, transcript variant C (Akt1), mRNA 
0   NM_169706.1  CG4006-RA, transcript variant A (Akt1), mRNA 
0   NM_136652.2  CG1809-RA (CG1809), mRNA 
0   NM_135248.1  CG13776-RA (CG13776), mRNA 
0   NM_080253.2  CG5067-RA (cic), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   13  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   13  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_080147.2  CG5965-RA (woc), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.