National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14351R-3 
 Symbol CG14351  Full Name CG14351 
 CG No CG14351  Old CG No CG14351 
 Synonyms tartan/capricious-like, CT33985, CG14351 
 Accession No (Link to NCBI) NM_134763.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kurusu M, Cording A, Taniguchi M, Menon K, Suzuki E, Zinn K.
A screen of cell-surface molecules identifies leucine-rich repeat proteins as key mediators of synaptic target selection.
Neuron (2008) 59(6) 972-85 [ PubMed ID = 18817735 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCGAACGACAACAGCTTTA 
 Primer Seq. 3'
aatctagaggtaccTCGGGAATGTGACTGAGCTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCCGAACGA CAACAGCTTT ACCAGCAGCG ACCACGCCCC TGNTCCTGCT ACTCCCACTT 
0061 ATCCTGGGCA GGCTCCACGT GGCCCACGCC CAGTGTCCTT GGCAGCGAGA TGTGCCCGAC 
0121 CTGCAGACGA GCTGCATCTG TGCCTACAAC CTGGGCAGAG AGCTATCCGT GCAGTGTGAT 
0181 CAGGTGGACT TTTCGCAACT CCTGGCTGCG ATGAACACCC ATGCCCGTCT GAAGCCCGTC 
0241 GGATTTGCTG TACGTGAACA ACTCCACGAT TTCCGAGCTT CCCGACGCCG TTTTCAGCAA 
0301 TTTGAGCCTG CACAATNTgC AGCTCTCGAG CTGCGGCATC CAGAGGATTG CGACGGGTGC 
0361 CTTTAAGGGC CAGGAGTCGG TGTTGCGGAA TCTCAATCTG CAGGATAATC TGNNGGCCGA 
0421 CGTGCCAGTG GAGGCGCTCA AGGTCCTGGG CAAGCTGAAC CTGCTGGATT TGTCAAAAAA 
0481 TCAGCTCAGT CACATTCCCG A 
 in silico PCR Fragment
0001 GGCCGAACGA CAACAGCTTT ACCAGCAGCG ACCACGCCCC TGCTCCTGCT ACTCCCACTT 
0061 ATCCTGGGCA GGCTCCACGT GGCCCACGCC CAGTGTCCTT GGCAGCGAGA TGTGCCCGAC 
0121 CTGCAGACGA GCTGCATCTG TGCCTACAAC CTGGGCAGAG AGCTATCCGT GCAGTGTGAT 
0181 CAGGTGGACT TTTCGCAACT CCTGGCTGCG ATGAACACCC ATGCCCGTCT GAAGCCCGT- 
0241 GGATTTGCTG TACGTGAACA ACTCCACGAT TTCCGAGCTT CCCGACGCCG TTTTCAGCAA 
0301 TTTGAGCCTG CACAATTTGC AGCTCTCGAG CTGCGGCATC CAGAGGATTG CGACGGGTGC 
0361 CTTTAAGGGC CAGGAGTCGG TGTTGCGGAA TCTCAATCTG CAGGATAATC TGCTGGCCGA 
0421 CGTGCCAGTG GAGGCGCTCA AGGTCCTGGG CAAGCTGAAC CTGCTGGATT TGTCAAAAAA 
0481 TCAGCTCAGT CACATTCCCG A 
 Assemble Data

14351R-3.IR_full       1   GGCCGAACGACAACAGCTTTACCAGCAGCGACCACGCCCCTGNTCCTGCTACTCCCACTT 60
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
14351R-3.in silico     1   GGCCGAACGACAACAGCTTTACCAGCAGCGACCACGCCCCTGCTCCTGCTACTCCCACTT 60


14351R-3.IR_full       61  ATCCTGGGCAGGCTCCACGTGGCCCACGCCCAGTGTCCTTGGCAGCGAGATGTGCCCGAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14351R-3.in silico     61  ATCCTGGGCAGGCTCCACGTGGCCCACGCCCAGTGTCCTTGGCAGCGAGATGTGCCCGAC 120


14351R-3.IR_full       121 CTGCAGACGAGCTGCATCTGTGCCTACAACCTGGGCAGAGAGCTATCCGTGCAGTGTGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14351R-3.in silico     121 CTGCAGACGAGCTGCATCTGTGCCTACAACCTGGGCAGAGAGCTATCCGTGCAGTGTGAT 180


14351R-3.IR_full       181 CAGGTGGACTTTTCGCAACTCCTGGCTGCGATGAACACCCATGCCCGTCTGAAGCCCGTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
14351R-3.in silico     181 CAGGTGGACTTTTCGCAACTCCTGGCTGCGATGAACACCCATGCCCGTCTGAAGCCCGT- 240


14351R-3.IR_full       241 GGATTTGCTGTACGTGAACAACTCCACGATTTCCGAGCTTCCCGACGCCGTTTTCAGCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14351R-3.in silico     241 GGATTTGCTGTACGTGAACAACTCCACGATTTCCGAGCTTCCCGACGCCGTTTTCAGCAA 300


14351R-3.IR_full       301 TTTGAGCCTGCACAATNTGCAGCTCTCGAGCTGCGGCATCCAGAGGATTGCGACGGGTGC 360
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
14351R-3.in silico     301 TTTGAGCCTGCACAATTTGCAGCTCTCGAGCTGCGGCATCCAGAGGATTGCGACGGGTGC 360


14351R-3.IR_full       361 CTTTAAGGGCCAGGAGTCGGTGTTGCGGAATCTCAATCTGCAGGATAATCTGNNGGCCGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
14351R-3.in silico     361 CTTTAAGGGCCAGGAGTCGGTGTTGCGGAATCTCAATCTGCAGGATAATCTGCTGGCCGA 420


14351R-3.IR_full       421 CGTGCCAGTGGAGGCGCTCAAGGTCCTGGGCAAGCTGAACCTGCTGGATTTGTCAAAAAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14351R-3.in silico     421 CGTGCCAGTGGAGGCGCTCAAGGTCCTGGGCAAGCTGAACCTGCTGGATTTGTCAAAAAA 480


14351R-3.IR_full       481 TCAGCTCAGTCACATTCCCGA 501
                           |||||||||||||||||||||
14351R-3.in silico     481 TCAGCTCAGTCACATTCCCGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134763.1  CG14351-RA (CG14351), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_143516.2  CG15529-RA (CG15529), mRNA 
0   NM_167560.1  CG32563-RA (CG32563), mRNA 
0   NM_132371.1  CG15314-RA (CG15314), mRNA 
0   NM_001014630.1  CG33547-RA (Rim), mRNA 
0   17  NM_167686.1  CG11940-RB, transcript variant B (CG11940), mRNA 
0   17  NM_134519.1  CG11940-RA, transcript variant A (CG11940), mRNA 
0   NM_176359.1  CG9614-RK, transcript variant K (pip), mRNA 
0   NM_135744.1  CG6180-RA (CG6180), mRNA 
0   16  NM_080055.2  CG3895-RA (ph-d), mRNA 
0   NM_132689.2  CG11151-RA (CG11151), mRNA 
0   NM_079149.3  CG17046-RA, transcript variant A (klar), mRNA 
0   NM_001043111.1  CG17046-RB, transcript variant B (klar), mRNA 
0   NM_142881.2  CG6763-RA (CG6763), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   NM_142351.2  CG12265-RA (CG12265), mRNA 
0   NM_142075.1  CG14358-RA (CG14358), mRNA 
0   NM_132415.1  CG9806-RA (CG9806), mRNA 
0   NM_166632.1  CG5594-RB, transcript variant B (CG5594), mRNA 
0   NM_131901.2  CG5594-RC, transcript variant C (CG5594), mRNA 
0   NM_132789.2  CG6170-RA, transcript variant A (HDAC6), mRNA 
0   NM_167436.1  CG6170-RB, transcript variant B (HDAC6), mRNA 
0   NM_167437.1  CG6170-RC, transcript variant C (HDAC6), mRNA 
0   NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0   NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
0   NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
0   NM_132248.2  CG12125-RA (CG12125), mRNA 
0   NM_134319.3  CG10033-RD, transcript variant D (for), mRNA 
0   NM_058142.3  CG10033-RE, transcript variant E (for), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.