National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14343R-1 
 Symbol CG14343  Full Name CG14343 
 CG No CG14343  Old CG No CG14343 
 Synonyms CG14343 
 Accession No (Link to NCBI) NM_134745.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGATCGTGGCCTTGATCGGG 
 Primer Seq. 3'
aatctagaggtaccGACCAGACATCCATCGACTGA 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 NTGATCGTGG CCTTGATCGG GATCATGGGG GTGGGAGTAC TAACCACTGC CCAGACGTAC 
0061 AGCTCCAAGG ACCTGTTGAC TTGGATGCAG TCCAGCAACT TCGGCTACCA GGTGCTCCAG 
0121 CAGGCCTTGA ATGACAACCA ATCCTCATCT GCTGCCGAGG CATCTTGCCT GGcGGAGGTT 
0181 CGCCTCCTCC TCACGGGAGC AGAGGCCAAA TCCTTGCCTG CTCTTCGAGT TTTCGATGCC 
0241 TGGGGAAAGT TCCCGCAAGG ACTGCTCTAC GGCCACTTTA TGGACATGGG CAACTACGAA 
0301 TCCTGCCTCA GCTTGGATCT CAGCAAGAGT CTGGGCAATG TCATGACCAT CAATGCCGGA 
0361 GCCAAGTATT GCTTGAGTCG TATGCAGTTC GAGAGTTTGC TCATGGAAGC CGCCGGCGCA 
0421 GATGCCCCTC ACCTTGAGTA TTGGAACCTG CATACCCTCA TCCTGCAGTG CCGCCCAACT 
0481 CAGTCGATGG ATGTCTGGTC  
 in silico PCR Fragment
0001 ATGATCGTGG CCTTGATCGG GATCATGGGG GTGGGAGTAC TAACCACTGC CCAGACGTAC 
0061 AGCTCCAAGG ACCTGTTGAC TTGGATGCAG TCCAGCAACT TCGGCTACCA GGTGCTCCAG 
0121 CAGGCCTTGA ATGACAACCA ATCCTCATCT GCTGCCGAGG CATCTTGCCT GGCGGAGGTT 
0181 CGCCTCCTCC TCACGGGAGC AGAGGCCAAA TCCTTGCCTG CTCTTCGAGT TTTCGATGCC 
0241 TGGGGAAAGT TCCCGCAAGG ACTGCTCTAC GGCCACTTTA TGGACATGGG CAACTACGAA 
0301 TCCTGCCTCA GCTTGGATCT CAGCAAGAGT CTGGGCAATG TCATGACCAT CAATGCCGGA 
0361 GCCAAGTATT GCTTGAGTCG TATGCAGTTC GAGAGTTTGC TCATGGAAGC CGCCGGCGCA 
0421 GATG-CCCTC ACCTTGAGTA TTGGAACCTG CATACCCTCA TCCTGCAGTG CCGCCCAACT 
0481 CAGTCGATGG ATGTCTGGTC  
 Assemble Data

14343R-1.IR_full        1   TGATCGTGGCCTTGATCGGGATCATGGGGGTGGGAGTACTAACCACTGCCCAGACGTAC 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico      1   TGATCGTGGCCTTGATCGGGATCATGGGGGTGGGAGTACTAACCACTGCCCAGACGTAC 59


14343R-1.IR_full       61  AGCTCCAAGGACCTGTTGACTTGGATGCAGTCCAGCAACTTCGGCTACCAGGTGCTCCAG 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico     61  AGCTCCAAGGACCTGTTGACTTGGATGCAGTCCAGCAACTTCGGCTACCAGGTGCTCCAG 119


14343R-1.IR_full       121 CAGGCCTTGAATGACAACCAATCCTCATCTGCTGCCGAGGCATCTTGCCTGGCGGAGGTT 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico     121 CAGGCCTTGAATGACAACCAATCCTCATCTGCTGCCGAGGCATCTTGCCTGGCGGAGGTT 179


14343R-1.IR_full       181 CGCCTCCTCCTCACGGGAGCAGAGGCCAAATCCTTGCCTGCTCTTCGAGTTTTCGATGCC 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico     181 CGCCTCCTCCTCACGGGAGCAGAGGCCAAATCCTTGCCTGCTCTTCGAGTTTTCGATGCC 239


14343R-1.IR_full       241 TGGGGAAAGTTCCCGCAAGGACTGCTCTACGGCCACTTTATGGACATGGGCAACTACGAA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico     241 TGGGGAAAGTTCCCGCAAGGACTGCTCTACGGCCACTTTATGGACATGGGCAACTACGAA 299


14343R-1.IR_full       301 TCCTGCCTCAGCTTGGATCTCAGCAAGAGTCTGGGCAATGTCATGACCATCAATGCCGGA 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico     301 TCCTGCCTCAGCTTGGATCTCAGCAAGAGTCTGGGCAATGTCATGACCATCAATGCCGGA 359


14343R-1.IR_full       361 GCCAAGTATTGCTTGAGTCGTATGCAGTTCGAGAGTTTGCTCATGGAAGCCGCCGGCGCA 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico     361 GCCAAGTATTGCTTGAGTCGTATGCAGTTCGAGAGTTTGCTCATGGAAGCCGCCGGCGCA 419


14343R-1.IR_full       421 GATGCCCCTCACCTTGAGTATTGGAACCTGCATACCCTCATCCTGCAGTGCCGCCCAACT 479
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
14343R-1.in silico     421 GATG-CCCTCACCTTGAGTATTGGAACCTGCATACCCTCATCCTGCAGTGCCGCCCAACT 479


14343R-1.IR_full       481 CAGTCGATGGATGTCTGGTC 499
                           ||||||||||||||||||||
14343R-1.in silico     481 CAGTCGATGGATGTCTGGTC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_134745.1  CG14343-RA (CG14343), mRNA 
0   NM_139808.1  CG10064-RA (CG10064), mRNA 
0   NM_137498.1  CG15069-RA, transcript variant A (Rgk2), mRNA 
0   NM_139499.2  CG2107-RA (CG2107), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_206636.1  CG3960-RF, transcript variant F (CG3960), mRNA 
0   NM_078581.2  CG1500-RA (fw), mRNA 
0   NM_141819.1  CG5281-RA (CG5281), mRNA 
0   NM_135179.2  CG9508-RA (CG9508), mRNA 
0   NM_142957.1  CG13605-RA (CG13605), mRNA 
0   NM_140931.1  CG7290-RA (CG7290), mRNA 
0   NM_206308.2  CG4432-RC, transcript variant C (PGRP-LC), mRNA 
0   NM_135068.2  CG10833-RA (Cyp28d1), mRNA 
0   NR_001734.1  CR30066, miscRNA 
0   NM_144358.2  CG14233-RA (meso18E), mRNA 
0   NM_168324.2  CG4432-RA, transcript variant A (PGRP-LC), mRNA 
0   NM_136653.3  CG1884-RA, transcript variant A (Not1), mRNA 
0   NM_165678.2  CG1884-RB, transcript variant B (Not1), mRNA 
0   NM_140041.2  CG4432-RB, transcript variant B (PGRP-LC), mRNA 
0   NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 
0   NM_078706.2  CG1403-RA, transcript variant A (Sep1), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_001042818.1  CG5055-RB, transcript variant B (baz), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_078659.3  CG5055-RA, transcript variant A (baz), mRNA 
0   NM_142294.2  CG14886-RA (Gyc-89Db), mRNA 
0   NM_001043254.1  CG14885-RB, transcript variant B (Gyc-89Da), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.