National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14341R-3 
 Symbol CG14341  Full Name CG14341 
 CG No CG14341  Old CG No CG14341 
 Synonyms CG14341 
 Accession No (Link to NCBI) NM_134736.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGAGGGACTTCCAACCCCAC 
 Primer Seq. 3'
aatctagaggtaccGTTGTTAATCCGGTCCAGCAG 
 Predicted Fragment Size
440 
 IR fragment full Seq
0001 AAGAGGGACT TCCAACCCCA CCGGTTGACC ATCCACGGGG AGGGGTGGAG AGCGAGGATG 
0061 ACGATGATTC GGATGCATAC GACGGCTACC AACCACTCGC TTTGGATGAG GAGAACGATG 
0121 CAGCGGATCC CGAGGAGATG TCCAGGGAGC AGGAGACCCC GTCCGCGGAT AATGACGAAG 
0181 ATGTTGACCT GATGACTACC CCAGTCACCC ACGGAGACCC CAACATGCCT GCCATTGAGC 
0241 CCGCTGACGT GGAAATCGAG AGACAAGTCT GGAGTGAACC AAGACCCAGG GAACTCCAAA 
0301 TGGATCTTGA CAAAACTCGA ACGGAGCAGA TACTCAAAGC GATGTCCACT ATAACGTTAC 
0361 CCAACATCAC AGTGCCGGAT TGGGCCAAAG GAGTGCCCGA GGAGCATTGG AAGCATGAGC 
0421 TGCTGGCGGT TACACGGTAA TTAACGGAAC  
 in silico PCR Fragment
0001 AAGAGGGACT TCCAACCCCA CCGGTTGACC ATCCACGGGG AGGGGTGGAG AGCGAGGATG 
0061 ACGATGATTC GGATGCATAC GACGGCTACC AACCACTCGC TTTGGATGAG GAGAACGATG 
0121 CAGCGGATCC CGAGGAGATG TCCAGGGAGC AGGAGACCCC GTCCGCGGAT AATGACGAAG 
0181 ATGTTGACCT GATGACTGCC CCAGTCACCC ACGGAGACCC CAACATGCCT GCCATTGAGC 
0241 CCGCTGACGT GGAAATCGAG AGACAAGTCT GGAGTGAACC AAGACCCAGG GAACTCCAAA 
0301 TGGATCTTGA CAAAACTCGA ACGGAACAGA TACTCAAAGC GATGTCCACT ATAACGTTAC 
0361 CCAACATCAC AGTGCCGGAT TGGGCCAGAG GAGTGCCCGA GGAGCATTGG AAGCATGAGC 
0421 TGCTGG---- -AC-CGG--A TTAAC--AAC  
 Assemble Data

14341R-3.IR_full       1   AAGAGGGACTTCCAACCCCACCGGTTGACCATCCACGGGGAGGGGTGGAGAGCGAGGATG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14341R-3.in silico     1   AAGAGGGACTTCCAACCCCACCGGTTGACCATCCACGGGGAGGGGTGGAGAGCGAGGATG 60


14341R-3.IR_full       61  ACGATGATTCGGATGCATACGACGGCTACCAACCACTCGCTTTGGATGAGGAGAACGATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14341R-3.in silico     61  ACGATGATTCGGATGCATACGACGGCTACCAACCACTCGCTTTGGATGAGGAGAACGATG 120


14341R-3.IR_full       121 CAGCGGATCCCGAGGAGATGTCCAGGGAGCAGGAGACCCCGTCCGCGGATAATGACGAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14341R-3.in silico     121 CAGCGGATCCCGAGGAGATGTCCAGGGAGCAGGAGACCCCGTCCGCGGATAATGACGAAG 180


14341R-3.IR_full       181 ATGTTGACCTGATGACTACCCCAGTCACCCACGGAGACCCCAACATGCCTGCCATTGAGC 240
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
14341R-3.in silico     181 ATGTTGACCTGATGACTGCCCCAGTCACCCACGGAGACCCCAACATGCCTGCCATTGAGC 240


14341R-3.IR_full       241 CCGCTGACGTGGAAATCGAGAGACAAGTCTGGAGTGAACCAAGACCCAGGGAACTCCAAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14341R-3.in silico     241 CCGCTGACGTGGAAATCGAGAGACAAGTCTGGAGTGAACCAAGACCCAGGGAACTCCAAA 300


14341R-3.IR_full       301 TGGATCTTGACAAAACTCGAACGGAGCAGATACTCAAAGCGATGTCCACTATAACGTTAC 360
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
14341R-3.in silico     301 TGGATCTTGACAAAACTCGAACGGAACAGATACTCAAAGCGATGTCCACTATAACGTTAC 360


14341R-3.IR_full       361 CCAACATCACAGTGCCGGATTGGGCCAAAGGAGTGCCCGAGGAGCATTGGAAGCATGAGC 420
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
14341R-3.in silico     361 CCAACATCACAGTGCCGGATTGGGCCAGAGGAGTGCCCGAGGAGCATTGGAAGCATGAGC 420


14341R-3.IR_full       421 TGCTGGCGGTTACACGGTAATTAACGGAAC 450
                           ||||||     || |||  ||||||  |||
14341R-3.in silico     421 TGCTGG-----AC-CGG--ATTAAC--AAC 450

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   422  NM_134736.2  CG14341-RB, transcript variant B (CG14341), mRNA 
96.44   407  NM_164407.1  CG14341-RA, transcript variant A (CG14341), mRNA 
0   NM_136046.2  CG15161-RA (CG15161), mRNA 
0   NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
0   NM_079914.2  CG9936-RD, transcript variant D (skd), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_132367.1  CG15252-RA (CG15252), mRNA 
0   NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0   NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0   NM_135340.2  CG8668-RA (CG8668), mRNA 
0   NM_166413.2  CG10052-RA (Rx), mRNA 
0   NM_137155.2  CG10228-RA (Pcf11), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_175954.1  CG33123-RA (CG33123), mRNA 
0   NM_057609.4  CG7704-RA (Taf5), mRNA 
0   NM_143414.2  CG11881-RA (CG11881), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 
0   NM_140496.2  CG6859-RA (CG6859), mRNA 
0   NM_135525.1  CG5604-RA (CG5604), mRNA 
0   NM_132981.1  CG8675-RA (CG8675), mRNA 
0   NM_079470.2  CG10564-RA (Ac78C), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 
0   NM_139970.2  CG6983-RA (CG6983), mRNA 
0   NM_139800.2  CG8549-RA (CG8549), mRNA 
0   NM_140561.3  CG5931-RA (CG5931), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.