National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14334R-3 
 Symbol beat-IIa  Full Name beaten path IIa 
 CG No CG14334  Old CG No CG14334 
 Synonyms beat IIa, CT33965, CG14335, CG14334, BcDNA:RE17794, beat-IIa 
 Accession No (Link to NCBI) NM_079660.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCAGCCGGCGACTTGAGCGAAATTCCCAAAATGGGACACCAAAGGGCCACGGATACGGG- 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACATCGCCAGATCCGGAGCCACAGAAAATCCGACTGCCGGACTTTTCCAGCCAGATGCCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCTGCTGCTACTCGGCGTTCTACTTCTGAGCATGGAGCTCGTCGAATGCGCGCTGCGCAA 180

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TG-TCAATTTAATAATCGAACCACCGGCAGTGCGACGGGGCCAGCATGTGGTGCTGCGGT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCATGTACGACCTGGACGGGGCTCCACTGTACTCGGCTAAGTTCTACCGTGGCCAGCTGG 300

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGTTCT-ACCGCTACACGCCCGGCGAGTTTCCCAATACGAAAGTGTTTCCATTCCCCGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATTCACGTGGATGTAAGCAGCTCCAATGCCACCCAGGTGCTGTTGCGCAACGTGGGATTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGTCTCTCTGGCAACTTTTCATGCGAAGTGACCGCCGATGCCCCGCTCTTCTCAACCGCC 480

14334R-3.IR_full       481 ACCGCAGTGGACACCATGCAAGT 503
                           ||||||||||||||||||||||| silico     481 ACCGCAGTGGACACCATGCAAGT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079660.3  CG14334-RA (beat-IIa), mRNA 
0   13  NM_078855.2  CG7644-RA (beat-Ib), mRNA 
0   NM_166688.1  CG30426-RA (CG30426), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_057393.3  CG3158-RA (spn-E), mRNA 
0   NM_136794.1  CG13231-RA (CG13231), mRNA 
0   NM_140049.2  CG3672-RA (CG3672), mRNA 
0   NM_078776.4  CG31629-RA, transcript variant A (Pvf3), mRNA 
0   19  32  NM_142356.2  CG4135-RA (beat-IIb), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_130639.2  CG2918-RA (CG2918), mRNA 
0   NM_132443.1  CG16922-RA (CG16922), mRNA 
0   NM_142717.2  CG15498-RA (CG15498), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   NM_142714.2  CG7922-RA (CG7922), mRNA 
0   NM_135704.2  CG5336-RA (Ced-12), mRNA 
0   NM_079007.2  CG17716-RA (fas), mRNA 
0   11  NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_001042880.1  CG31902-RB (CG31902), mRNA 
0   NM_143362.2  CG14064-RA (beat-VI), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_080251.2  CG12833-RB, transcript variant B (esn), mRNA 
0   NM_165507.1  CG12833-RA, transcript variant A (esn), mRNA 
0   NM_165544.1  CG2092-RA, transcript variant A (scra), mRNA 
0   NM_165543.1  CG2092-RB, transcript variant B (scra), mRNA 
0   NM_137360.1  CG6568-RA (CG6568), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.