National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14334R-2 
 Symbol beat-IIa  Full Name beaten path IIa 
 CG No CG14334  Old CG No CG14334 
 Synonyms beat IIa, CT33965, CG14335, CG14334, BcDNA:RE17794, beat-IIa 
 Accession No (Link to NCBI) NM_079660.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCAGCCGGCGACTTGAGCGAA 
 Primer Seq. 3'
aatctagaggtaccACTTGCATGGTGTCCACTGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCAGCCGGCG ACTTGAGCGA AATTCCCAAA ATGGGACACC AAAGGGCCAC GGATACGGGT 
0061 ACATCGCCAG ATCCGGAGCC ACAGAAAATC CGACTGCCGG ACTTTTCCAG CCAGATGCCT 
0121 CCTGCTGCTA CTCGGCGTTC TACTTCTGAG CATGGAGCTC GTCGAATGCG CGCTGCGCAA 
0181 TGNTCAATTT AATAATCGAA CCACCGGCAG TGCGACGGGG CCAGCATGTG GTGCTGCGGT 
0241 GCATGTACGA CCTGGACGGG GCTCCACTGT ACTCGGCTAA GTTCTACCGT GGCCAGCTGG 
0301 AGTTCTAACC GCTACACGCC CGGCGAGTTT CCCAATACGA AAGTGTTTCC ATTCCCCGGC 
0361 ATTCACGTGG ATGTAAGCAG CTCCAATGCC ACCCAGGTGC TGTTGCGCAA CGTGGGATTC 
0421 GGTCTCTCTG GCAACTTTTC ATGCGAAGTG ACCGCCGATG CCCCGCTCTT CTCAACCGCC 
0481 ACCGCAGTGG ACACCATGCA AGT 
 in silico PCR Fragment
0001 TCAGCCGGCG ACTTGAGCGA AATTCCCAAA ATGGGACACC AAAGGGCCAC GGATACGGG- 
0061 ACATCGCCAG ATCCGGAGCC ACAGAAAATC CGACTGCCGG ACTTTTCCAG CCAGATGCCT 
0121 CCTGCTGCTA CTCGGCGTTC TACTTCTGAG CATGGAGCTC GTCGAATGCG CGCTGCGCAA 
0181 TG-TCAATTT AATAATCGAA CCACCGGCAG TGCGACGGGG CCAGCATGTG GTGCTGCGGT 
0241 GCATGTACGA CCTGGACGGG GCTCCACTGT ACTCGGCTAA GTTCTACCGT GGCCAGCTGG 
0301 AGTTCT-ACC GCTACACGCC CGGCGAGTTT CCCAATACGA AAGTGTTTCC ATTCCCCGGC 
0361 ATTCACGTGG ATGTAAGCAG CTCCAATGCC ACCCAGGTGC TGTTGCGCAA CGTGGGATTC 
0421 GGTCTCTCTG GCAACTTTTC ATGCGAAGTG ACCGCCGATG CCCCGCTCTT CTCAACCGCC 
0481 ACCGCAGTGG ACACCATGCA AGT 
 Assemble Data

14334R-2.IR_full       1   TCAGCCGGCGACTTGAGCGAAATTCCCAAAATGGGACACCAAAGGGCCACGGATACGGGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
14334R-2.in silico     1   TCAGCCGGCGACTTGAGCGAAATTCCCAAAATGGGACACCAAAGGGCCACGGATACGGG- 60


14334R-2.IR_full       61  ACATCGCCAGATCCGGAGCCACAGAAAATCCGACTGCCGGACTTTTCCAGCCAGATGCCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14334R-2.in silico     61  ACATCGCCAGATCCGGAGCCACAGAAAATCCGACTGCCGGACTTTTCCAGCCAGATGCCT 120


14334R-2.IR_full       121 CCTGCTGCTACTCGGCGTTCTACTTCTGAGCATGGAGCTCGTCGAATGCGCGCTGCGCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14334R-2.in silico     121 CCTGCTGCTACTCGGCGTTCTACTTCTGAGCATGGAGCTCGTCGAATGCGCGCTGCGCAA 180


14334R-2.IR_full       181 TGNTCAATTTAATAATCGAACCACCGGCAGTGCGACGGGGCCAGCATGTGGTGCTGCGGT 240
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14334R-2.in silico     181 TG-TCAATTTAATAATCGAACCACCGGCAGTGCGACGGGGCCAGCATGTGGTGCTGCGGT 240


14334R-2.IR_full       241 GCATGTACGACCTGGACGGGGCTCCACTGTACTCGGCTAAGTTCTACCGTGGCCAGCTGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14334R-2.in silico     241 GCATGTACGACCTGGACGGGGCTCCACTGTACTCGGCTAAGTTCTACCGTGGCCAGCTGG 300


14334R-2.IR_full       301 AGTTCTAACCGCTACACGCCCGGCGAGTTTCCCAATACGAAAGTGTTTCCATTCCCCGGC 360
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
14334R-2.in silico     301 AGTTCT-ACCGCTACACGCCCGGCGAGTTTCCCAATACGAAAGTGTTTCCATTCCCCGGC 360


14334R-2.IR_full       361 ATTCACGTGGATGTAAGCAGCTCCAATGCCACCCAGGTGCTGTTGCGCAACGTGGGATTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14334R-2.in silico     361 ATTCACGTGGATGTAAGCAGCTCCAATGCCACCCAGGTGCTGTTGCGCAACGTGGGATTC 420


14334R-2.IR_full       421 GGTCTCTCTGGCAACTTTTCATGCGAAGTGACCGCCGATGCCCCGCTCTTCTCAACCGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14334R-2.in silico     421 GGTCTCTCTGGCAACTTTTCATGCGAAGTGACCGCCGATGCCCCGCTCTTCTCAACCGCC 480


14334R-2.IR_full       481 ACCGCAGTGGACACCATGCAAGT 503
                           |||||||||||||||||||||||
14334R-2.in silico     481 ACCGCAGTGGACACCATGCAAGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079660.3  CG14334-RA (beat-IIa), mRNA 
0   13  NM_078855.2  CG7644-RA (beat-Ib), mRNA 
0   NM_166688.1  CG30426-RA (CG30426), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_057393.3  CG3158-RA (spn-E), mRNA 
0   NM_136794.1  CG13231-RA (CG13231), mRNA 
0   NM_140049.2  CG3672-RA (CG3672), mRNA 
0   NM_078776.4  CG31629-RA, transcript variant A (Pvf3), mRNA 
0   19  32  NM_142356.2  CG4135-RA (beat-IIb), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_130639.2  CG2918-RA (CG2918), mRNA 
0   NM_132443.1  CG16922-RA (CG16922), mRNA 
0   NM_142717.2  CG15498-RA (CG15498), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   NM_142714.2  CG7922-RA (CG7922), mRNA 
0   NM_135704.2  CG5336-RA (Ced-12), mRNA 
0   NM_079007.2  CG17716-RA (fas), mRNA 
0   11  NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_001042880.1  CG31902-RB (CG31902), mRNA 
0   NM_143362.2  CG14064-RA (beat-VI), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_080251.2  CG12833-RB, transcript variant B (esn), mRNA 
0   NM_165507.1  CG12833-RA, transcript variant A (esn), mRNA 
0   NM_165544.1  CG2092-RA, transcript variant A (scra), mRNA 
0   NM_165543.1  CG2092-RB, transcript variant B (scra), mRNA 
0   NM_137360.1  CG6568-RA (CG6568), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.