National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14329R-1 
 Symbol CG14329  Full Name CG14329 
 CG No CG14329  Old CG No CG14329 
 Synonyms CG14329 
 Accession No (Link to NCBI) NM_142379.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTTCTACTCCTTCTGGGAGC 
 Primer Seq. 3'
aatctagaggtaccGATCAGACAGAAGACCTCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTTCTACTC CTTCTGGGAG CCTTGGGCTA TTCGTTGGCC TATCCGCGCA CCTATAGTTA 
0061 CGAGTATCCC CGCCGAAGGG CCTACTCCAC ATCGTATTCC GGGAATTCGT ATAGCTCTTT 
0121 GGCCGGTCGG AAGGCTAGGG AAGAAAGTAC CACCAGCAAA TCGGACAAGG AGAATGCCAA 
0181 GTTTGCTGGT GCTTCCAATC AGGAATTGGA TGAAACCGGT GACGAACGCA CACTGCTGCT 
0241 TAAAAAGAAG CTCAAGAGGT TGGCCAGGCC CTACCTAGGA GGATATGGTG GATATGGCGG 
0301 ATATGGTGGA TATGGCGGAT ATGGAGGATA CGGCGGTGGT CCCTGCTCCC CGTTTGGTCG 
0361 CGATGCTCGA GGTGGTCAGA ATCAGAAGGA TCCCGCTGAA CAGGGTCGCT TTCTGTTCGA 
0421 CGTGAATGTG GTGAAAGTAT ATCCCGGTGG ATGTCGCGGC TATGGAGGAG GTGGTTTGGG 
0481 TGGAGGTCTT CTGTCTGATC  
 in silico PCR Fragment
0001 TCTTCTACTC CTTCTGGGAG CCTTGGGCTA TTCGTTGGCC TATCCGCGCA CCTATAGTTA 
0061 CGAGTATCCC CGCCGAAGGG CCTACTCCAC ATCGTATTCC GGGAATTCGT ATAGCTCTTT 
0121 GGCCGGTCGG AAGGCTAGGG AAGAAAGTAC CACCAGCAAA TCGGACAAGG AGAATGCCAA 
0181 GTTTGCTGGT GCTTCCAATC AGGAATTGGA TGAAACCGGT GACGAACGCA CACTGCTGCT 
0241 TAAAAAGAAG CTCAAGAGGT TGGCCAGGCC CTACCTAGGA GGATATGGTG GATATGGCGG 
0301 ATATGGTGGA TATGGCGGAT ATGGAGGATA CGGCGGTGGT CCCTGCTCCC CGTTTGGTCG 
0361 CGATGCTCGA GGTGGTCAGA ATCAGAAGGA TCCCGCTGAA CAGGGTCGCT TTCTGTTCGA 
0421 CGTGAATGTG GTGAAAGTAT ATCCCGGTGG ATGTCGCGGC TATGGAGGAG GTGGTTTGGG 
0481 TGGAGGTCTT CTGTCTGATC  
 Assemble Data

14329R-1.IR_full       1   TCTTCTACTCCTTCTGGGAGCCTTGGGCTATTCGTTGGCCTATCCGCGCACCTATAGTTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     1   TCTTCTACTCCTTCTGGGAGCCTTGGGCTATTCGTTGGCCTATCCGCGCACCTATAGTTA 60


14329R-1.IR_full       61  CGAGTATCCCCGCCGAAGGGCCTACTCCACATCGTATTCCGGGAATTCGTATAGCTCTTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     61  CGAGTATCCCCGCCGAAGGGCCTACTCCACATCGTATTCCGGGAATTCGTATAGCTCTTT 120


14329R-1.IR_full       121 GGCCGGTCGGAAGGCTAGGGAAGAAAGTACCACCAGCAAATCGGACAAGGAGAATGCCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     121 GGCCGGTCGGAAGGCTAGGGAAGAAAGTACCACCAGCAAATCGGACAAGGAGAATGCCAA 180


14329R-1.IR_full       181 GTTTGCTGGTGCTTCCAATCAGGAATTGGATGAAACCGGTGACGAACGCACACTGCTGCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     181 GTTTGCTGGTGCTTCCAATCAGGAATTGGATGAAACCGGTGACGAACGCACACTGCTGCT 240


14329R-1.IR_full       241 TAAAAAGAAGCTCAAGAGGTTGGCCAGGCCCTACCTAGGAGGATATGGTGGATATGGCGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     241 TAAAAAGAAGCTCAAGAGGTTGGCCAGGCCCTACCTAGGAGGATATGGTGGATATGGCGG 300


14329R-1.IR_full       301 ATATGGTGGATATGGCGGATATGGAGGATACGGCGGTGGTCCCTGCTCCCCGTTTGGTCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     301 ATATGGTGGATATGGCGGATATGGAGGATACGGCGGTGGTCCCTGCTCCCCGTTTGGTCG 360


14329R-1.IR_full       361 CGATGCTCGAGGTGGTCAGAATCAGAAGGATCCCGCTGAACAGGGTCGCTTTCTGTTCGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     361 CGATGCTCGAGGTGGTCAGAATCAGAAGGATCCCGCTGAACAGGGTCGCTTTCTGTTCGA 420


14329R-1.IR_full       421 CGTGAATGTGGTGAAAGTATATCCCGGTGGATGTCGCGGCTATGGAGGAGGTGGTTTGGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14329R-1.in silico     421 CGTGAATGTGGTGAAAGTATATCCCGGTGGATGTCGCGGCTATGGAGGAGGTGGTTTGGG 480


14329R-1.IR_full       481 TGGAGGTCTTCTGTCTGATC 500
                           ||||||||||||||||||||
14329R-1.in silico     481 TGGAGGTCTTCTGTCTGATC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
103.31  498  18  78  60  NM_142379.3  CG14329-RA (CG14329), mRNA 
0   39  32  80  NM_136997.1  CG15870-RA (CG15870), mRNA 
0   27  92  NM_169765.1  CG14328-RA (CG14328), mRNA 
0   13  21  NM_132196.2  CG10777-RB (CG10777), mRNA 
0   18  NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   18  NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   18  NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   16  32  NM_139712.1  CG13285-RA (CG13285), mRNA 
0   11  NM_165960.1  CG3798-RE, transcript variant E (Nmda1), mRNA 
0   11  NM_165957.1  CG3798-RB, transcript variant B (Nmda1), mRNA 
0   11  NM_165958.1  CG3798-RD, transcript variant D (Nmda1), mRNA 
0   11  NM_165959.1  CG3798-RF, transcript variant F (Nmda1), mRNA 
0   11  NM_165956.1  CG3798-RA, transcript variant A (Nmda1), mRNA 
0   11  NM_078998.2  CG3798-RC, transcript variant C (Nmda1), mRNA 
0   NM_137691.2  CG9346-RA (CG9346), mRNA 
0   NM_167021.1  CG2861-RB, transcript variant B (CG2861), mRNA 
0   NM_131961.1  CG2861-RA, transcript variant A (CG2861), mRNA 
0   NM_169620.1  CG31303-RA (CG31303), mRNA 
0   NM_079436.1  CG31303-RA (CG31303), mRNA, small, or homeotic discs 1 CG8887-RA (ash1), mRNA 
0   NM_170175.1  CG31105-RA (CG31105), mRNA 
0   NM_167082.2  CG4095-RA (CG4095), mRNA 
0   NM_078993.2  CG8604-RA (Amph), mRNA 
0   NM_136601.1  CG8197-RA (CG8197), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_141639.1  CG16779-RA (CG16779), mRNA 
0   NM_142402.1  CG17802-RA (CG17802), mRNA 
0   NM_142254.1  CG5470-RA (CG5470), mRNA 
0   21  NM_133118.2  CG14191-RA (CG14191), mRNA 
0   25  NM_167869.1  CG9184-RA, transcript variant A (CG9184), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.