National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14327R-1 
 Symbol CG14327  Full Name CG14327 
 CG No CG14327  Old CG No CG14327 
 Synonyms BcDNA:RE25364, CG14327 
 Accession No (Link to NCBI) NM_142380.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAACCTGGATGAAACGTCTGC 
 Primer Seq. 3'
aatctagaggtaccCACCATAACTGGATCCTTCAC 
 Predicted Fragment Size
389 
 IR fragment full Seq
0001 TAACCTGGAT GAAACGTCTG CTGGAAAAGT TAAGTTACTA GCCTTTAAGG GACCCCATGC 
0061 CGGATTTGTG GGTCTCAAGG TTCGCACTCC CAAGTTGCTG GGCCTAAAAA GCGGATTGGT 
0121 GGGTGGAGCA GCTGGATTTG GACTTGGTGC GGCGGTTGGC GCTAAGTTGG GCGCTGGATT 
0181 AGCAGGATTA ACAAGCCATG CTGGTGGTTT GGGAGGTGGT ATTGGAGGAG GTTATGGAGG 
0241 AGGATATGGC GGAGGATACG GCGGAGGATT CGGCGGAGGA TACGGCGGAG GATACGGTGG 
0301 AGGATATGGC GGAGGATACG GAAGGAGCAG CGGCTACGAA CACCATGAGT ACCACGAAAG 
0361 CCACCACAGT GAAGGATCCA GTTATGGTG 
 in silico PCR Fragment
0001 TAACCTGGAT GAAACGTCTG CTGGAAAAGT TAAGTTACTA GCCTTTAAGG GACCCCATGC 
0061 CGGATTTGTG GGTCTCAAGG TTCGCACTCC CAAGTTGCTG GGCCTAAAAA GCGGATTGGT 
0121 GGGTGGAGCA GCTGGATTTG GACTTGGTGC GGCGGTTGGC GCTAAGTTGG GCGCTGGATT 
0181 AGCTGGATTA ACAAGCCATG CTGGTGGTCT TGGAGGTGGT ATTGGAGGAG GTTATGGAGG 
0241 AGGATACGGC GGAGGATACG GCGGAGGATT CGGCGGAGGA TACGGCGGAG GATACGGTGG 
0301 AGGATATGGC GGAGGATACG GAAGGAGCAG CGGCTACGAA CACCATGAGT ACCACGAAAG 
0361 CCACCACAGT GAAGGATCCA GTTATGGTG 
 Assemble Data

14327R-1.IR_full       1   TAACCTGGATGAAACGTCTGCTGGAAAAGTTAAGTTACTAGCCTTTAAGGGACCCCATGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14327R-1.in silico     1   TAACCTGGATGAAACGTCTGCTGGAAAAGTTAAGTTACTAGCCTTTAAGGGACCCCATGC 60


14327R-1.IR_full       61  CGGATTTGTGGGTCTCAAGGTTCGCACTCCCAAGTTGCTGGGCCTAAAAAGCGGATTGGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14327R-1.in silico     61  CGGATTTGTGGGTCTCAAGGTTCGCACTCCCAAGTTGCTGGGCCTAAAAAGCGGATTGGT 120


14327R-1.IR_full       121 GGGTGGAGCAGCTGGATTTGGACTTGGTGCGGCGGTTGGCGCTAAGTTGGGCGCTGGATT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14327R-1.in silico     121 GGGTGGAGCAGCTGGATTTGGACTTGGTGCGGCGGTTGGCGCTAAGTTGGGCGCTGGATT 180


14327R-1.IR_full       181 AGCAGGATTAACAAGCCATGCTGGTGGTTTGGGAGGTGGTATTGGAGGAGGTTATGGAGG 240
                           ||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||
14327R-1.in silico     181 AGCTGGATTAACAAGCCATGCTGGTGGTCTTGGAGGTGGTATTGGAGGAGGTTATGGAGG 240


14327R-1.IR_full       241 AGGATATGGCGGAGGATACGGCGGAGGATTCGGCGGAGGATACGGCGGAGGATACGGTGG 300
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
14327R-1.in silico     241 AGGATACGGCGGAGGATACGGCGGAGGATTCGGCGGAGGATACGGCGGAGGATACGGTGG 300


14327R-1.IR_full       301 AGGATATGGCGGAGGATACGGAAGGAGCAGCGGCTACGAACACCATGAGTACCACGAAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14327R-1.in silico     301 AGGATATGGCGGAGGATACGGAAGGAGCAGCGGCTACGAACACCATGAGTACCACGAAAG 360


14327R-1.IR_full       361 CCACCACAGTGAAGGATCCAGTTATGGTG 389
                           |||||||||||||||||||||||||||||
14327R-1.in silico     361 CCACCACAGTGAAGGATCCAGTTATGGTG 389

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
105.92  393  132  136  146  NM_142380.2  CG14327-RA (CG14327), mRNA 
0   31  59  NM_169765.1  CG14328-RA (CG14328), mRNA 
0   22  75  NM_132970.1  CG5070-RA (CG5070), mRNA 
0   14  82  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   14  NM_132126.1  CG3075-RA (CG3075), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   13  46  NM_132433.1  CG2157-RA (CG2157), mRNA 
0   27  NM_206095.1  CG13214-RB, transcript variant B (CG13214), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 
0   34  NM_165451.2  CG11680-RC, transcript variant C (mle), mRNA 
0   34  NM_057293.3  CG11680-RA, transcript variant A (mle), mRNA 
0   34  NM_057294.4  CG11680-RB, transcript variant B (mle), mRNA 
0   13  NM_133127.1  CG7453-RA, transcript variant A (CG7453), mRNA 
0   13  NM_167639.1  CG7453-RB, transcript variant B (CG7453), mRNA 
0   NM_164578.1  CG15427-RA, transcript variant A (tutl), mRNA 
0   NM_079008.2  CG6315-RA, transcript variant A (fl(2)d), mRNA 
0   NM_079488.3  CG9054-RA (Ddx1), mRNA 
0   10  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   10  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_165667.1  CG2040-RA, transcript variant A (hig), mRNA 
0   NM_165666.1  CG2040-RB, transcript variant B (hig), mRNA 
0   NM_001014514.1  CG2040-RD, transcript variant D (hig), mRNA 
0   NM_080371.2  CG2040-RC, transcript variant C (hig), mRNA 
0   NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0   NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0   NM_142040.1  CG9269-RA (CG9269), mRNA 
0   NM_135336.2  CG7466-RA (CG7466), mRNA 
0   NM_079461.2  CG5219-RA (mRpL15), mRNA 
0   15  95  NM_141375.1  CG15597-RA (CG15597), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.