National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14326R-2 
 Symbol CG14326  Full Name CG14326 
 CG No CG14326  Old CG No CG14326 
 Synonyms BcDNA:RE19820, CG14326 
 Accession No (Link to NCBI) NM_142382.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTCAAGATTAGCTGTTCGC 
 Primer Seq. 3'
aatctagaggtaccATCCACCGTATGGATTGCCGT 
 Predicted Fragment Size
402 
 IR fragment full Seq
0001 TGGTCAAGAT TAGCTGTTCG CTGCTGGTGC TCCTTTCGCT TTGCGCTTGT TCATACGCTC 
0061 AATATGAGTA TCCACAGCAG CGCCCTTCGC CGGGAACTGG AGCTCAGCCT ACTGGTGGGC 
0121 AAGTAGACAA TCGTATCCTT GGAAATCTCC TCGGTGGCGG AGGAGGACTC CTTGGAGGCG 
0181 GCGGTGGCGG TGGAGGACTT TTCGGAAATT TATTGGGCGG CCTTTTGGGT GGCAATCGTC 
0241 CGCAACCGCA GCCCTACCCA GTGCCAGTTC CCGCATATGG GGGCGGATTC GGCGGTGGAT 
0301 ACCCAATCGG AGGAGGCGGA TATGCTGGCG GTCTTCCTGG TGGTTATCCA GGTGGCTTTG 
0361 GCGGCGGCTT CGGTGGCGGA TACGGCAATC CATACGGTGG AT 
 in silico PCR Fragment
0001 TGGTCAAGAT TAGCTGTTCG CTGCTGGTGC TCCTTTCGCT TTGCGCTTGT TCATACGCTC 
0061 AATATGAGTA TCCACAGCAG CGCCCTTCGC CGGGAACTGG AGCTCAGCCT ACTGGTGGGC 
0121 AAGTAGACAA TCGTATCCTT GGAAATCTCC TCGGTGGCGG AGGAGGACTC CTTGGAGGCG 
0181 GCGGTGGCGG TGGAGGACTT TTCGGAAATT TATTGGGCGG CCTTTTGGGT GGCAATCGTC 
0241 CGCAACCGCA GCCCTACCCA GTGCCAGTTC CCGCATATGG GGGCGGATTC GGCGGTGGAT 
0301 ACCCAATCGG AGGAGGCGGA TATGCTGGCG GTCTTCCTGG TGGTTATCCA GGTGGCTTTG 
0361 GCGGCGGCTT CGGTGGCGGA TACGGCAATC CATACGGTGG AT 
 Assemble Data

14326R-2.IR_full       1   TGGTCAAGATTAGCTGTTCGCTGCTGGTGCTCCTTTCGCTTTGCGCTTGTTCATACGCTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14326R-2.in silico     1   TGGTCAAGATTAGCTGTTCGCTGCTGGTGCTCCTTTCGCTTTGCGCTTGTTCATACGCTC 60


14326R-2.IR_full       61  AATATGAGTATCCACAGCAGCGCCCTTCGCCGGGAACTGGAGCTCAGCCTACTGGTGGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14326R-2.in silico     61  AATATGAGTATCCACAGCAGCGCCCTTCGCCGGGAACTGGAGCTCAGCCTACTGGTGGGC 120


14326R-2.IR_full       121 AAGTAGACAATCGTATCCTTGGAAATCTCCTCGGTGGCGGAGGAGGACTCCTTGGAGGCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14326R-2.in silico     121 AAGTAGACAATCGTATCCTTGGAAATCTCCTCGGTGGCGGAGGAGGACTCCTTGGAGGCG 180


14326R-2.IR_full       181 GCGGTGGCGGTGGAGGACTTTTCGGAAATTTATTGGGCGGCCTTTTGGGTGGCAATCGTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14326R-2.in silico     181 GCGGTGGCGGTGGAGGACTTTTCGGAAATTTATTGGGCGGCCTTTTGGGTGGCAATCGTC 240


14326R-2.IR_full       241 CGCAACCGCAGCCCTACCCAGTGCCAGTTCCCGCATATGGGGGCGGATTCGGCGGTGGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14326R-2.in silico     241 CGCAACCGCAGCCCTACCCAGTGCCAGTTCCCGCATATGGGGGCGGATTCGGCGGTGGAT 300


14326R-2.IR_full       301 ACCCAATCGGAGGAGGCGGATATGCTGGCGGTCTTCCTGGTGGTTATCCAGGTGGCTTTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14326R-2.in silico     301 ACCCAATCGGAGGAGGCGGATATGCTGGCGGTCTTCCTGGTGGTTATCCAGGTGGCTTTG 360


14326R-2.IR_full       361 GCGGCGGCTTCGGTGGCGGATACGGCAATCCATACGGTGGAT 402
                           ||||||||||||||||||||||||||||||||||||||||||
14326R-2.in silico     361 GCGGCGGCTTCGGTGGCGGATACGGCAATCCATACGGTGGAT 402

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   384  14  NM_142382.1  CG14326-RA (CG14326), mRNA 
1.04   11  49  NM_057695.3  CG4038-RA (CG4038), mRNA 
0.78   NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0.78   NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0.78   NM_135607.2  CG6495-RA (CG6495), mRNA 
0.78   14  NM_079478.3  CG5069-RA (croc), mRNA 
0.78   18  25  NM_137910.2  CG9877-RA (CG9877), mRNA 
0.26   NM_140877.2  CG9376-RA (CG9376), mRNA 
0.26   23  NM_132652.2  CG1987-RA (Rbp1-like), mRNA 
0   14  12  NM_136802.1  CG13227-RA (CG13227), mRNA 
0   38  86  NM_078641.2  CG3606-RB, transcript variant B (caz), mRNA 
0   38  86  NM_167493.1  CG3606-RA, transcript variant A (caz), mRNA 
0   17  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   15  60  NM_135594.2  CG7294-RA (CG7294), mRNA 
0   15  NM_140314.2  CG10698-RA (GRHRII), mRNA 
0   NM_001043110.1  CG6883-RB, transcript variant B (trh), mRNA 
0   NM_079148.2  CG6883-RA, transcript variant A (trh), mRNA 
0   26  NM_130552.2  CG3056-RA, transcript variant A (CG3056), mRNA 
0   26  NM_206603.1  CG3056-RB, transcript variant B (CG3056), mRNA 
0   25  NM_057327.3  CG9757-RA (CG9757), mRNA 
0   13  NM_143343.2  CG4963-RA (CG4963), mRNA 
0   NM_170646.3  CG31349-RE, transcript variant E (pyd), mRNA 
0   24  97  NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   10  22  NM_135591.2  CG17107-RA (CG17107), mRNA 
0   15  NM_132953.1  CG13001-RA (CG13001), mRNA 
0   33  NM_169121.1  CG10279-RF, transcript variant F (Rm62), mRNA 
0   33  NM_169122.1  CG10279-RB, transcript variant B (Rm62), mRNA 
0   33  NM_079519.2  CG10279-RA, transcript variant A (Rm62), mRNA 
0   33  NM_169120.1  CG10279-RC, transcript variant C (Rm62), mRNA 
0   33  NM_169119.1  CG10279-RE, transcript variant E (Rm62), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.