National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14326R-1 
 Symbol CG14326  Full Name CG14326 
 CG No CG14326  Old CG No CG14326 
 Synonyms BcDNA:RE19820, CG14326 
 Accession No (Link to NCBI) NM_142382.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGTCAAGATTAGCTGTTCGCTGCTGGTGCTCCTTTCGCTTTGCGCTTGTTCATACGCTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AATATGAGTATCCACAGCAGCGCCCTTCGCCGGGAACTGGAGCTCAGCCTACTGGTGGGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGTAGACAATCGTATCCTTGGAAATCTCCTCGGTGGCGGAGGAGGACTCCTTGGAGGCG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCGGTGGCGGTGGAGGACTTTTCGGAAATTTATTGGGCGGCCTTTTGGGTGGCAATCGTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCAACCGCAGCCCTACCCAGTGCCAGTTCCCGCATATGGGGGCGGATTCGGCGGTGGAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACCCAATCGGAGGAGGCGGATATGCTGGCGGTCTTCCTGGTGGTTATCCAGGTGGCTTTG 360

                           |||||||||||||||||||||||||||||||||||||||||| silico     361 GCGGCGGCTTCGGTGGCGGATACGGCAATCCATACGGTGGAT 402

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   384  14  NM_142382.1  CG14326-RA (CG14326), mRNA 
1.04   11  49  NM_057695.3  CG4038-RA (CG4038), mRNA 
0.78   NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0.78   NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0.78   NM_135607.2  CG6495-RA (CG6495), mRNA 
0.78   14  NM_079478.3  CG5069-RA (croc), mRNA 
0.78   18  25  NM_137910.2  CG9877-RA (CG9877), mRNA 
0.26   NM_140877.2  CG9376-RA (CG9376), mRNA 
0.26   23  NM_132652.2  CG1987-RA (Rbp1-like), mRNA 
0   14  12  NM_136802.1  CG13227-RA (CG13227), mRNA 
0   38  86  NM_078641.2  CG3606-RB, transcript variant B (caz), mRNA 
0   38  86  NM_167493.1  CG3606-RA, transcript variant A (caz), mRNA 
0   17  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   15  60  NM_135594.2  CG7294-RA (CG7294), mRNA 
0   15  NM_140314.2  CG10698-RA (GRHRII), mRNA 
0   NM_001043110.1  CG6883-RB, transcript variant B (trh), mRNA 
0   NM_079148.2  CG6883-RA, transcript variant A (trh), mRNA 
0   26  NM_130552.2  CG3056-RA, transcript variant A (CG3056), mRNA 
0   26  NM_206603.1  CG3056-RB, transcript variant B (CG3056), mRNA 
0   25  NM_057327.3  CG9757-RA (CG9757), mRNA 
0   13  NM_143343.2  CG4963-RA (CG4963), mRNA 
0   NM_170646.3  CG31349-RE, transcript variant E (pyd), mRNA 
0   24  97  NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   10  22  NM_135591.2  CG17107-RA (CG17107), mRNA 
0   15  NM_132953.1  CG13001-RA (CG13001), mRNA 
0   33  NM_169121.1  CG10279-RF, transcript variant F (Rm62), mRNA 
0   33  NM_169122.1  CG10279-RB, transcript variant B (Rm62), mRNA 
0   33  NM_079519.2  CG10279-RA, transcript variant A (Rm62), mRNA 
0   33  NM_169120.1  CG10279-RC, transcript variant C (Rm62), mRNA 
0   33  NM_169119.1  CG10279-RE, transcript variant E (Rm62), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.