National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14324R-3 
 Symbol CG14324  Full Name CG14324 
 CG No CG14324  Old CG No CG14324 
 Synonyms BcDNA:RE34075, CG14324 
 Accession No (Link to NCBI) NM_169766.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTTGGGTCTGTCCCTGCTGC 
 Primer Seq. 3'
aatctagaggtaccCTAAAGGTGCCACCACCCAAT 
 Predicted Fragment Size
364 
 IR fragment full Seq
0001 TTTTGGGTCT GTCCCTGCTG CTTTGTTTGG CGCTTGCACA CTCACATGGT TTTGGTGGAA 
0061 AGCTTGGAGG AGGCTACGCC CCTGTCTACA ACAACTTTGT CCCATATCCA GTTGCCCAAC 
0121 CGATCCCAGT GGCCCAACCT GTTCCAGTTC CCGTGGCTAT TCCTCAACCA ATTCCAGTCC 
0181 CAGTCCCCCA ACCAGTAGTT ATTCCCATCA AACACGGATG GAAGGGTGGT CTAGGTCTAG 
0241 GTGGATTTGG CGGAGGTTAT GGCGGCGGTT TCGGAGGCTA CCAGAACTTT GCCTCTGCCT 
0301 CCTCTTTTAG CTCTGCCAGT TCATTTGGCG GTGGCTATGG CGGATTGGGT GGTGGCACCT 
0361 TTAG 
 in silico PCR Fragment
0001 TTTTGGGTCT GTCCCTGCTG CTTTGTTTGG CGCTTGCACA CTCACATGGT TTTGGTGGAA 
0061 AGCTTGGAGG AGGCTACGCC CCTGTCTACA ACAACTTTGT CCCATATCCA GTTGCCCAAC 
0121 CGATCCCAGT GGCCCAACCT GTTCCAGTTC CCGTGGCTAT TCCTCAACCA ATTCCAGTCC 
0181 CAGTCCCCCA ACCAGTAGTT ATTCCCATCA AACACGGATG GAAGGGTGGT CTAGGTCTAG 
0241 GTGGATTTGG CGGAGGTTAT GGCGGCGGTT TCGGAGGCTA CCAGAACTTT GCCTCTGCCT 
0301 CCTCTTTTAG CTCTGCCAGT TCATTTGGCG GTGGCTATGG CGGATTGGGT GGTGGCACCT 
0361 TTAG 
 Assemble Data

14324R-3.IR_full       1   TTTTGGGTCTGTCCCTGCTGCTTTGTTTGGCGCTTGCACACTCACATGGTTTTGGTGGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14324R-3.in silico     1   TTTTGGGTCTGTCCCTGCTGCTTTGTTTGGCGCTTGCACACTCACATGGTTTTGGTGGAA 60


14324R-3.IR_full       61  AGCTTGGAGGAGGCTACGCCCCTGTCTACAACAACTTTGTCCCATATCCAGTTGCCCAAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14324R-3.in silico     61  AGCTTGGAGGAGGCTACGCCCCTGTCTACAACAACTTTGTCCCATATCCAGTTGCCCAAC 120


14324R-3.IR_full       121 CGATCCCAGTGGCCCAACCTGTTCCAGTTCCCGTGGCTATTCCTCAACCAATTCCAGTCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14324R-3.in silico     121 CGATCCCAGTGGCCCAACCTGTTCCAGTTCCCGTGGCTATTCCTCAACCAATTCCAGTCC 180


14324R-3.IR_full       181 CAGTCCCCCAACCAGTAGTTATTCCCATCAAACACGGATGGAAGGGTGGTCTAGGTCTAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14324R-3.in silico     181 CAGTCCCCCAACCAGTAGTTATTCCCATCAAACACGGATGGAAGGGTGGTCTAGGTCTAG 240


14324R-3.IR_full       241 GTGGATTTGGCGGAGGTTATGGCGGCGGTTTCGGAGGCTACCAGAACTTTGCCTCTGCCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14324R-3.in silico     241 GTGGATTTGGCGGAGGTTATGGCGGCGGTTTCGGAGGCTACCAGAACTTTGCCTCTGCCT 300


14324R-3.IR_full       301 CCTCTTTTAGCTCTGCCAGTTCATTTGGCGGTGGCTATGGCGGATTGGGTGGTGGCACCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14324R-3.in silico     301 CCTCTTTTAGCTCTGCCAGTTCATTTGGCGGTGGCTATGGCGGATTGGGTGGTGGCACCT 360


14324R-3.IR_full       361 TTAG 364
                           ||||
14324R-3.in silico     361 TTAG 364

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   346  NM_169766.1  CG14324-RA (CG14324), mRNA 
0.86   24  NM_135594.2  CG7294-RA (CG7294), mRNA 
0   10  13  NM_167559.1  CG32564-RA (CG32564), mRNA 
0   NM_132139.1  CG4575-RA (CG4575), mRNA 
0   16  NM_141375.1  CG15597-RA (CG15597), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_176202.1  CG4945-RB, transcript variant B (CG4945), mRNA 
0   NM_176203.1  CG4945-RC, transcript variant C (CG4945), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_132723.2  CG1839-RA (CG1839), mRNA 
0   20  NM_132970.1  CG5070-RA (CG5070), mRNA 
0   NM_138123.2  CG16912-RA (CG16912), mRNA 
0   14  NM_079307.1  CG7260-RA (byn), mRNA 
0   NM_140000.1  CG13310-RA (CG13310), mRNA 
0   20  NM_137006.2  CG4663-RA (CG4663), mRNA 
0   NM_135258.1  CG4497-RA (CG4497), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_135872.2  CG15282-RA (CG15282), mRNA 
0   NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_206263.1  CG11505-RC, transcript variant C (CG11505), mRNA 
0   NM_136374.2  CG3183-RA (geminin), mRNA 
0   NM_140717.2  CG13728-RA (CG13728), mRNA 
0   23  NM_135595.2  CG17108-RA (CG17108), mRNA 
0   NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.