National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14324R-1 
 Symbol CG14324  Full Name CG14324 
 CG No CG14324  Old CG No CG14324 
 Synonyms BcDNA:RE34075, CG14324 
 Accession No (Link to NCBI) NM_169766.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
0361 TTAG 
 in silico PCR Fragment
0361 TTAG 
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTTTGGGTCTGTCCCTGCTGCTTTGTTTGGCGCTTGCACACTCACATGGTTTTGGTGGAA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCTTGGAGGAGGCTACGCCCCTGTCTACAACAACTTTGTCCCATATCCAGTTGCCCAAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGATCCCAGTGGCCCAACCTGTTCCAGTTCCCGTGGCTATTCCTCAACCAATTCCAGTCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAGTCCCCCAACCAGTAGTTATTCCCATCAAACACGGATGGAAGGGTGGTCTAGGTCTAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTGGATTTGGCGGAGGTTATGGCGGCGGTTTCGGAGGCTACCAGAACTTTGCCTCTGCCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCTCTTTTAGCTCTGCCAGTTCATTTGGCGGTGGCTATGGCGGATTGGGTGGTGGCACCT 360

14324R-1.IR_full       361 TTAG 364
                           |||| silico     361 TTAG 364

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   346  NM_169766.1  CG14324-RA (CG14324), mRNA 
0.86   24  NM_135594.2  CG7294-RA (CG7294), mRNA 
0   10  13  NM_167559.1  CG32564-RA (CG32564), mRNA 
0   NM_132139.1  CG4575-RA (CG4575), mRNA 
0   16  NM_141375.1  CG15597-RA (CG15597), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_176202.1  CG4945-RB, transcript variant B (CG4945), mRNA 
0   NM_176203.1  CG4945-RC, transcript variant C (CG4945), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_132723.2  CG1839-RA (CG1839), mRNA 
0   20  NM_132970.1  CG5070-RA (CG5070), mRNA 
0   NM_138123.2  CG16912-RA (CG16912), mRNA 
0   14  NM_079307.1  CG7260-RA (byn), mRNA 
0   NM_140000.1  CG13310-RA (CG13310), mRNA 
0   20  NM_137006.2  CG4663-RA (CG4663), mRNA 
0   NM_135258.1  CG4497-RA (CG4497), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_135872.2  CG15282-RA (CG15282), mRNA 
0   NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_206263.1  CG11505-RC, transcript variant C (CG11505), mRNA 
0   NM_136374.2  CG3183-RA (geminin), mRNA 
0   NM_140717.2  CG13728-RA (CG13728), mRNA 
0   23  NM_135595.2  CG17108-RA (CG17108), mRNA 
0   NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.