National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14323R-1 
 Symbol CG14323  Full Name CG14323 
 CG No CG14323  Old CG No CG14323 
 Synonyms CG14323 
 Accession No (Link to NCBI) NM_169767.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGATCATACAGGACCAGAA 
 Primer Seq. 3'
aatctagaggtaccGGGTATTGGAAGGGTATTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGATCATA CAGGACCAGA ACCAATCGAT GGACGATCGT TTTTCTTTCT GGGTACTTTG 
0061 TTTCGTCGTT GGCGTAACCG CTGGATGGCC TCTCACAATC CGGATCCCAT ATTCGCCGGC 
0121 CCCGCCTATC CCATATCTGG TTATTACAAT TGTCCTGTAT ATGGCTGCAG CCTGGCGGCT 
0181 ATTGGTCCTC AACCAGGTTA CTACGCTACA CCTGCAGGAT TTTATACCAT GCCTCTGAAT 
0241 CAGCAGCAGG CTCAGGGGAA CAGCAATGTG TATATCTATC AAAGTGATCA AAATTCCGCG 
0301 ACGTCTGGAA GTCCCATGGG CTATGGGTAT CTGAGCGGAg cTTCGCCGAT ACGACCAgcT 
0361 CCGCCTTTCC CTCCACCACC ACCTGGTATN CCACCGCCCA CATcCGTTGG AACGGTACAG 
0421 GCCAGCGCAG GTGGGTATTC TGGACCAGGA GCAGGACCTG GACAACGGCC AGGACCGTTT 
0481 CCAATACCCT TCCAATACCC  
 in silico PCR Fragment
0001 CCAGATCATA CAGGACCAGA ACCAATCGAT GGACGATCGT TTTTCTTTCT GGGTACTTTG 
0061 TTTCGTCGTT GGCGTAACCG CTGGATGGCC TCTCACAATC CGGATCCCAT ATTCGCCGGC 
0121 CCCGCCTATC CCATATCTGG TTATTACAAT TGTCCTGTAT ATGGCTGCAG CCTGGCGGCT 
0181 ATTGGTCCTC AACCAGGTTA CTACGCTACA CCTGCAGGAT TTTACACCAT GCCTCTGAAT 
0241 CAGCAGCAGG CTCAGGGGAA CAGCAATGTG TATATCTATC AAAGTGATCA AAATTCCGCG 
0301 ACGTCTGGAA GTCCCATGGG CTATGGGTAT CTGAGCGGAG CTTCGCCGAT ACGACCAGCT 
0361 CCGCCTTTCC CTCCACCACC ACCTGGTATG CCACCGCCCA CATCCGTTGG AACGGTACAG 
0421 GCCAGCGCAG GTGGGTATTC TGGACCAGGA GCAGGACCTG GACAACGGCC AGGACCGTTT 
0481 CCAATACCCT TCCAATACCC  
 Assemble Data

14323R-1.IR_full       1   CCAGATCATACAGGACCAGAACCAATCGATGGACGATCGTTTTTCTTTCTGGGTACTTTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14323R-1.in silico     1   CCAGATCATACAGGACCAGAACCAATCGATGGACGATCGTTTTTCTTTCTGGGTACTTTG 60


14323R-1.IR_full       61  TTTCGTCGTTGGCGTAACCGCTGGATGGCCTCTCACAATCCGGATCCCATATTCGCCGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14323R-1.in silico     61  TTTCGTCGTTGGCGTAACCGCTGGATGGCCTCTCACAATCCGGATCCCATATTCGCCGGC 120


14323R-1.IR_full       121 CCCGCCTATCCCATATCTGGTTATTACAATTGTCCTGTATATGGCTGCAGCCTGGCGGCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14323R-1.in silico     121 CCCGCCTATCCCATATCTGGTTATTACAATTGTCCTGTATATGGCTGCAGCCTGGCGGCT 180


14323R-1.IR_full       181 ATTGGTCCTCAACCAGGTTACTACGCTACACCTGCAGGATTTTATACCATGCCTCTGAAT 240
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
14323R-1.in silico     181 ATTGGTCCTCAACCAGGTTACTACGCTACACCTGCAGGATTTTACACCATGCCTCTGAAT 240


14323R-1.IR_full       241 CAGCAGCAGGCTCAGGGGAACAGCAATGTGTATATCTATCAAAGTGATCAAAATTCCGCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14323R-1.in silico     241 CAGCAGCAGGCTCAGGGGAACAGCAATGTGTATATCTATCAAAGTGATCAAAATTCCGCG 300


14323R-1.IR_full       301 ACGTCTGGAAGTCCCATGGGCTATGGGTATCTGAGCGGAGCTTCGCCGATACGACCAGCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14323R-1.in silico     301 ACGTCTGGAAGTCCCATGGGCTATGGGTATCTGAGCGGAGCTTCGCCGATACGACCAGCT 360


14323R-1.IR_full       361 CCGCCTTTCCCTCCACCACCACCTGGTATNCCACCGCCCACATCCGTTGGAACGGTACAG 420
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
14323R-1.in silico     361 CCGCCTTTCCCTCCACCACCACCTGGTATGCCACCGCCCACATCCGTTGGAACGGTACAG 420


14323R-1.IR_full       421 GCCAGCGCAGGTGGGTATTCTGGACCAGGAGCAGGACCTGGACAACGGCCAGGACCGTTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14323R-1.in silico     421 GCCAGCGCAGGTGGGTATTCTGGACCAGGAGCAGGACCTGGACAACGGCCAGGACCGTTT 480


14323R-1.IR_full       481 CCAATACCCTTCCAATACCC 500
                           ||||||||||||||||||||
14323R-1.in silico     481 CCAATACCCTTCCAATACCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169767.1  CG14323-RA (CG14323), mRNA 
0   NM_137530.1  CG15080-RA (CG15080), mRNA 
0   NM_142876.3  CG4467-RA, transcript variant A (CG4467), mRNA 
0   NM_001043282.1  CG4467-RB, transcript variant B (CG4467), mRNA 
0   NM_142421.2  CG7218-RA (CG7218), mRNA 
0   NM_206505.1  CG18212-RB, transcript variant B (CG18212), mRNA 
0   NM_169771.1  CG18212-RF, transcript variant F (CG18212), mRNA 
0   NM_169770.2  CG18212-RE, transcript variant E (CG18212), mRNA 
0   NM_142388.2  CG18212-RG, transcript variant G (CG18212), mRNA 
0   NM_169768.1  CG18212-RA, transcript variant A (CG18212), mRNA 
0   NM_169769.1  CG18212-RD, transcript variant D (CG18212), mRNA 
0   NM_078545.2  CG12653-RA (btd), mRNA 
0   NM_130638.2  CG2924-RC, transcript variant C (CG2924), mRNA 
0   NM_166935.1  CG2924-RA, transcript variant A (CG2924), mRNA 
0   NM_142504.2  CG17836-RB, transcript variant B (CG17836), mRNA 
0   NM_169839.1  CG17836-RA, transcript variant A (CG17836), mRNA 
0   NM_169840.1  CG17836-RC, transcript variant C (CG17836), mRNA 
0   NM_169841.1  CG17836-RD, transcript variant D (CG17836), mRNA 
0   NM_167349.1  CG32645-RB (CG32645), mRNA 
0   12  NM_132734.2  CG9411-RA (CG9411), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_136905.1  CG8854-RA (CG8854), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
0   NM_165626.1  CG8740-RB, transcript variant B (CG8740), mRNA 
0   NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.