National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14270R-3 
 Symbol CG14270  Full Name CG14270 
 CG No CG14270  Old CG No CG14270 
 Synonyms CG14270 
 Accession No (Link to NCBI) NM_130707.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCGAATTCAGATGCCGGAGC 
 Primer Seq. 3'
aatctagaggtaccGTTGCGCATCTTCCATTTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCGAATTCA GATGCCGGAG CGCTTCAAGG GCACGTTCGT GGAGAAGTGG GTGCAGTATT 
0061 GGAACGGCCT GGTCAGGGAC TACACAGAGG TGGCAGTGGG TGTTGTGCGA GAATCCTACA 
0121 CGAAGCCGAA AAAGGCGCTT CTCTATGGAA CGGGAATGCT GTTCATGTAC CAAGCCAATC 
0181 TGAAGAATCC CGGCGAGGCA GGCCTTTATG ACTCTGCTAA GGGGTGCCAC AAATCGAATG 
0241 ATCACAGTGC CGGTAGAACT TCAGAATCCC GTGTCCGCCG ACTATCTGCT AACCTTGGAG 
0301 AGGGCGATCA ATCAAAAGAA ACTGCGTCTC CTTTCTCTCG GCATCTGCAC GATCCTTTGG 
0361 GTGGATCTAT ACGACGAGGA CGACTGCACC TATCCGGCCA TCTGTGAATA TACCAACGTG 
0421 GGCGTCTTCA ACTTCCACGA ACGGATCATC GATGTGGGAT TTTGGAATCA ATACTGGCGA 
0481 CTCAAATGGA AGATGCGCAA C 
 in silico PCR Fragment
0001 ATCGAATTCA GATGCCGGAG CGCTTCAAGG GCACGTTCGT GGAGAAGTGG GTGCAGTATT 
0061 GGAACGGCCT GGTCAGGGAC TACACAGAGG TGGCAGTGGG TGTTGTGCGA GAATCCTACA 
0121 CGAAGCCGAA AAAGGCGCTT CTCTATGGAA CGGGAATGCT GTTCATGTAC CAAGCCAATC 
0181 TGAAGAATCC CGGCGAGG-A GGCCTTTATG ACTCTGCTAA GGGGTGCCAC AAATCGAATG 
0241 ATCACAGTGC CGGTAGAACT TCAGAATCCC GTGTCCGCCG ACTATCTGCT AACCTTGGAG 
0301 AGGGCGATCA ATCAAAAGAA ACTGCGTCTC CTTTCTCTCG GCATCTGCAC GATCCTTTGG 
0361 GTGGATCTAT ACGACGAGGA CGACTGCACC TATCCGGCCA TCTGTGAATA TACCAACGTG 
0421 GGCGTCTTCA ACTTCCACGA ACGGATCATC GATGTGGGAT TTTGGAATCA ATACTGGCGA 
0481 CTCAAATGGA AGATGCGCAA C 
 Assemble Data

14270R-3.IR_full       1   ATCGAATTCAGATGCCGGAGCGCTTCAAGGGCACGTTCGTGGAGAAGTGGGTGCAGTATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     1   ATCGAATTCAGATGCCGGAGCGCTTCAAGGGCACGTTCGTGGAGAAGTGGGTGCAGTATT 60


14270R-3.IR_full       61  GGAACGGCCTGGTCAGGGACTACACAGAGGTGGCAGTGGGTGTTGTGCGAGAATCCTACA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     61  GGAACGGCCTGGTCAGGGACTACACAGAGGTGGCAGTGGGTGTTGTGCGAGAATCCTACA 120


14270R-3.IR_full       121 CGAAGCCGAAAAAGGCGCTTCTCTATGGAACGGGAATGCTGTTCATGTACCAAGCCAATC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     121 CGAAGCCGAAAAAGGCGCTTCTCTATGGAACGGGAATGCTGTTCATGTACCAAGCCAATC 180


14270R-3.IR_full       181 TGAAGAATCCCGGCGAGGCAGGCCTTTATGACTCTGCTAAGGGGTGCCACAAATCGAATG 240
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     181 TGAAGAATCCCGGCGAGG-AGGCCTTTATGACTCTGCTAAGGGGTGCCACAAATCGAATG 240


14270R-3.IR_full       241 ATCACAGTGCCGGTAGAACTTCAGAATCCCGTGTCCGCCGACTATCTGCTAACCTTGGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     241 ATCACAGTGCCGGTAGAACTTCAGAATCCCGTGTCCGCCGACTATCTGCTAACCTTGGAG 300


14270R-3.IR_full       301 AGGGCGATCAATCAAAAGAAACTGCGTCTCCTTTCTCTCGGCATCTGCACGATCCTTTGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     301 AGGGCGATCAATCAAAAGAAACTGCGTCTCCTTTCTCTCGGCATCTGCACGATCCTTTGG 360


14270R-3.IR_full       361 GTGGATCTATACGACGAGGACGACTGCACCTATCCGGCCATCTGTGAATATACCAACGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     361 GTGGATCTATACGACGAGGACGACTGCACCTATCCGGCCATCTGTGAATATACCAACGTG 420


14270R-3.IR_full       421 GGCGTCTTCAACTTCCACGAACGGATCATCGATGTGGGATTTTGGAATCAATACTGGCGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14270R-3.in silico     421 GGCGTCTTCAACTTCCACGAACGGATCATCGATGTGGGATTTTGGAATCAATACTGGCGA 480


14270R-3.IR_full       481 CTCAAATGGAAGATGCGCAAC 501
                           |||||||||||||||||||||
14270R-3.in silico     481 CTCAAATGGAAGATGCGCAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130707.1  CG14270-RA (CG14270), mRNA 
0   14  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   10  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   NM_079109.2  CG5575-RA (ken), mRNA 
0   NM_080054.2  CG1560-RA (mys), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_057511.3  CG3936-RA (N), mRNA 
0   NM_169100.1  CG2082-RA, transcript variant A (CG2082), mRNA 
0   NM_141327.3  CG2082-RB, transcript variant B (CG2082), mRNA 
0   NM_169099.1  CG2082-RC, transcript variant C (CG2082), mRNA 
0   11  NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_135239.1  CG18304-RA (CG18304), mRNA 
0   NM_001014546.1  CG4065-RB, transcript variant B (CG4065), mRNA 
0   NM_138047.2  CG4065-RA, transcript variant A (CG4065), mRNA 
0   NM_135142.1  CG13995-RA (CG13995), mRNA 
0   NM_206397.1  CG5992-RB, transcript variant B (Adgf-A), mRNA 
0   NM_079406.2  CG5992-RA, transcript variant A (Adgf-A), mRNA 
0   NM_080125.2  CG4399-RB (east), mRNA 
0   NM_164409.2  CG4896-RC, transcript variant C (CG4896), mRNA 
0   NM_164410.2  CG4896-RA, transcript variant A (CG4896), mRNA 
0   NM_134739.5  CG4896-RD, transcript variant D (CG4896), mRNA 
0   NM_164411.2  CG4896-RB, transcript variant B (CG4896), mRNA 
0   NM_143583.3  CG11317-RA (CG11317), mRNA 
0   NM_168540.1  CG11282-RB, transcript variant B (caps), mRNA 
0   NM_079332.2  CG11282-RA, transcript variant A (caps), mRNA 
0   NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_135356.2  CG14277-RA (CG14277), mRNA 
0   NM_142884.1  CG4408-RA (CG4408), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.