National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1424R-1 
 Symbol mst  Full Name misato 
 CG No CG1424  Old CG No CG1424 
 Synonyms CG1424, LB20, l(1)LB20, LB-20, l(1)LB14, unnamed, lLB14, l(1)19Fg, mst 
 Accession No (Link to NCBI) NM_078711.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Min S, Yoon W, Cho H, Chung J.
Misato underlies visceral myopathy in Drosophila.
Sci Rep (2017) 7(1) 17700 [ PubMed ID = 29255146 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTACGCGAATTACGTGGGCA 
 Primer Seq. 3'
aatctagaggtaccCAGCCCCGGCAAGACATTCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTACGCGAA TTACGTGGGC ACACACTTCT GGAACCAGCA GGAGGCCAAC TTTAGGTACG 
0061 GAGACGAAAG CGAACAGGTG GCCGAGGAGC AGCTGCCCAA CAATGATATT TTGTACCGTG 
0121 AAGGGCGCAA CGACCTCAAT CGTACCACCT ACACGCCCCG CCTGCTGTCC GTGGATTTGT 
0181 CCGGGACCCT GGGACATNCT GCCGGTGACC GGCGAGCNTG TACGGCAATT TTGTGCAGCG 
0241 TGATGAGGAG TTGCTGCCCC TGAGCACCGG AGAGGAATTG GAACAGGTTC GCAAGCGGGC 
0301 AGAGGAGAGC GGCGTATGCT CACCGGAGCA GCTGGAAGTG CAGGAGCAGT CGAAGGCCTC 
0361 CATTTCCGAA TATCAGCGGG ATCTGCTCAA GAATGCTGTG GTGCCCGAGA AGAACTATCA 
0421 GCTGGCAGCG ACGGCAAACA GTTGGGTGGA CTTCCTTTAC GCCAGGTATC ACCCGAGAAC 
0481 CTTGAATGTC TTGCCGGGGC TG 
 in silico PCR Fragment
0001 CGTACGCGAA TTACGTGGGC ACACACTTCT GGAACCAGCA GGAGGCCAAC TTTAGGTACG 
0061 GAGACGAAAG CGAACAGGTG GCCGAGGAGC AGCTGCCCAA CAATGATATT TTGTACCGTG 
0121 AAGGGCGCAA CGACCTCAAT CGTACCACCT ACACGCCCCG CCTGCTGTCC GTGGATTTGT 
0181 CCGGGACCCT GGGACAT-CT GCCGGTGACC GGCGAGC-TG TACGGCAATT TTGTGCAGCG 
0241 TGATGAGGAG TTGCTGCCCC TGAGCACCGG AGAGGAATTG GAACAGGTTC GCAAGCGGGC 
0301 AGAGGAGAGC GGCGTATGCT CACCGGAGCA GCTGGAAGTG CAGGAGCAGT CGAAGGCCTC 
0361 CATTTCCGAA TATCAGCGGG ATCTGCTCAA GAATGCTGTG GTGCCCGAGA AGAACTATCA 
0421 GCTGGCAGCG ACGGCAAACA GTTGGGTGGA CTTCCTTTAC GCCAGGTATC ACCCGAGAAC 
0481 CTTGAATGTC TTGCCGGGGC TG 
 Assemble Data

1424R-1.IR_full       1   CGTACGCGAATTACGTGGGCACACACTTCTGGAACCAGCAGGAGGCCAACTTTAGGTACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1424R-1.in silico     1   CGTACGCGAATTACGTGGGCACACACTTCTGGAACCAGCAGGAGGCCAACTTTAGGTACG 60


1424R-1.IR_full       61  GAGACGAAAGCGAACAGGTGGCCGAGGAGCAGCTGCCCAACAATGATATTTTGTACCGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1424R-1.in silico     61  GAGACGAAAGCGAACAGGTGGCCGAGGAGCAGCTGCCCAACAATGATATTTTGTACCGTG 120


1424R-1.IR_full       121 AAGGGCGCAACGACCTCAATCGTACCACCTACACGCCCCGCCTGCTGTCCGTGGATTTGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1424R-1.in silico     121 AAGGGCGCAACGACCTCAATCGTACCACCTACACGCCCCGCCTGCTGTCCGTGGATTTGT 180


1424R-1.IR_full       181 CCGGGACCCTGGGACATNCTGCCGGTGACCGGCGAGCNTGTACGGCAATTTTGTGCAGCG 240
                          ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||
1424R-1.in silico     181 CCGGGACCCTGGGACAT-CTGCCGGTGACCGGCGAGC-TGTACGGCAATTTTGTGCAGCG 240


1424R-1.IR_full       241 TGATGAGGAGTTGCTGCCCCTGAGCACCGGAGAGGAATTGGAACAGGTTCGCAAGCGGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1424R-1.in silico     241 TGATGAGGAGTTGCTGCCCCTGAGCACCGGAGAGGAATTGGAACAGGTTCGCAAGCGGGC 300


1424R-1.IR_full       301 AGAGGAGAGCGGCGTATGCTCACCGGAGCAGCTGGAAGTGCAGGAGCAGTCGAAGGCCTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1424R-1.in silico     301 AGAGGAGAGCGGCGTATGCTCACCGGAGCAGCTGGAAGTGCAGGAGCAGTCGAAGGCCTC 360


1424R-1.IR_full       361 CATTTCCGAATATCAGCGGGATCTGCTCAAGAATGCTGTGGTGCCCGAGAAGAACTATCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1424R-1.in silico     361 CATTTCCGAATATCAGCGGGATCTGCTCAAGAATGCTGTGGTGCCCGAGAAGAACTATCA 420


1424R-1.IR_full       421 GCTGGCAGCGACGGCAAACAGTTGGGTGGACTTCCTTTACGCCAGGTATCACCCGAGAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1424R-1.in silico     421 GCTGGCAGCGACGGCAAACAGTTGGGTGGACTTCCTTTACGCCAGGTATCACCCGAGAAC 480


1424R-1.IR_full       481 CTTGAATGTCTTGCCGGGGCTG 502
                          ||||||||||||||||||||||
1424R-1.in silico     481 CTTGAATGTCTTGCCGGGGCTG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.