National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14222R-3 
 Symbol CG14222  Full Name CG14222 
 CG No CG14222  Old CG No CG14222 
 Synonyms DmAAF48987, CG14222 
 Accession No (Link to NCBI) NM_134487.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Stephan D, Sánchez-Soriano N, Loschek LF, Gerhards R, Gutmann S, Storchova Z, Prokop A, Kadow IC.
Drosophila Psidin regulates olfactory neuron number and axon targeting through two distinct molecular mechanisms.
J. Neurosci. (2012) 32(46) 16080-94 [ PubMed ID = 23152593 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACCACGTTGCGACCCTTC 
 Primer Seq. 3'
aatctagaggtaccGGCTGCGTGTACGGTATGACC 
 Predicted Fragment Size
497 
 IR fragment full Seq
0001 ATGACCACGT TGCGACCCTT CACCTGCGAC GACCTCTTTA AGTTCAACAA TGTAAACTTT 
0061 GACCCACTTA CGGAGACCTA CGGGCTGTCC TTCTACACCC AGTACCTGGC CAAGTGGCCG 
0121 GAGTACTTTC AGCTTGCGGC AGTCGCCCAG CGGACAAATA ATGGGCTACA TCATGGGCAA 
0181 GGTGGAGGGA CACCTGGACA ACTGGCACGG ACACGTGACT GCGCTGACCG TCTCGCCCGA 
0241 CTACCGGCGC CTTGGTCTGG CTGCGCTGCT CATGAGTTTC CTGGAGGACA TTTCGGAGAA 
0301 AAAGCGAGCA TACTTTGTGG ATCTTTTTGT GAGGAAGAGC AACCAGGTGG CAATAAACAT 
0361 GTACACGAAC CTTGGCTACA TCATATACCG CACCATACTT GAGTACTACT CCGGCGACCA 
0421 GGACGAGGAA TGCGTACGAC ATGAGAAAGG CCTTATCCAG GGACGTCAAA CAAAAAGTCG 
0481 GGTCATACCG TACACGCANC C 
 in silico PCR Fragment
0001 ATGACCACGT TGCGACCCTT CACCTGCGAC GACCTCTTTA AGTTCAACAA TGTAAACTTT 
0061 GACCCACTTA CGGAGACCTA CGGGCTGTCC TTCTACACCC AGTACCTGGC CAAGTGGCCG 
0121 GAGTACTTTC AGCTTGCGG- AGTCGCCCAG CGGACAAATA ATGGGCTACA TCATGGGCAA 
0181 GGTGGAGGGA CACCTGGACA ACTGGCACGG ACACGTGACT GCGCTGACCG TCTCGCCCGA 
0241 CTACCGGCGC CTTGGTCTGG CTGCGCTGCT CATGAGTTTC CTGGAGGACA TTTCGGAGAA 
0301 AAAGCGAGCA TACTTTGTGG ATCTTTTTGT GAGGAAGAGC AACCAGGTGG CAATAAACAT 
0361 GTACACGAAC CTTGGCTACA TCATATACCG CACCATACTT GAGTACTACT CCGGCGACCA 
0421 GGACGAGG-A TGCGTACGAC ATGAGAAAGG CCTTATCCAG GGACGTC-AA CAAAAAGTC- 
0481 GGTCATACCG TACACGCAGC C 
 Assemble Data

14222R-3.IR_full       1   ATGACCACGTTGCGACCCTTCACCTGCGACGACCTCTTTAAGTTCAACAATGTAAACTTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14222R-3.in silico     1   ATGACCACGTTGCGACCCTTCACCTGCGACGACCTCTTTAAGTTCAACAATGTAAACTTT 60


14222R-3.IR_full       61  GACCCACTTACGGAGACCTACGGGCTGTCCTTCTACACCCAGTACCTGGCCAAGTGGCCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14222R-3.in silico     61  GACCCACTTACGGAGACCTACGGGCTGTCCTTCTACACCCAGTACCTGGCCAAGTGGCCG 120


14222R-3.IR_full       121 GAGTACTTTCAGCTTGCGGCAGTCGCCCAGCGGACAAATAATGGGCTACATCATGGGCAA 180
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
14222R-3.in silico     121 GAGTACTTTCAGCTTGCGG-AGTCGCCCAGCGGACAAATAATGGGCTACATCATGGGCAA 180


14222R-3.IR_full       181 GGTGGAGGGACACCTGGACAACTGGCACGGACACGTGACTGCGCTGACCGTCTCGCCCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14222R-3.in silico     181 GGTGGAGGGACACCTGGACAACTGGCACGGACACGTGACTGCGCTGACCGTCTCGCCCGA 240


14222R-3.IR_full       241 CTACCGGCGCCTTGGTCTGGCTGCGCTGCTCATGAGTTTCCTGGAGGACATTTCGGAGAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14222R-3.in silico     241 CTACCGGCGCCTTGGTCTGGCTGCGCTGCTCATGAGTTTCCTGGAGGACATTTCGGAGAA 300


14222R-3.IR_full       301 AAAGCGAGCATACTTTGTGGATCTTTTTGTGAGGAAGAGCAACCAGGTGGCAATAAACAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14222R-3.in silico     301 AAAGCGAGCATACTTTGTGGATCTTTTTGTGAGGAAGAGCAACCAGGTGGCAATAAACAT 360


14222R-3.IR_full       361 GTACACGAACCTTGGCTACATCATATACCGCACCATACTTGAGTACTACTCCGGCGACCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14222R-3.in silico     361 GTACACGAACCTTGGCTACATCATATACCGCACCATACTTGAGTACTACTCCGGCGACCA 420


14222R-3.IR_full       421 GGACGAGGAATGCGTACGACATGAGAAAGGCCTTATCCAGGGACGTCAAACAAAAAGTCG 480
                           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| 
14222R-3.in silico     421 GGACGAGG-ATGCGTACGACATGAGAAAGGCCTTATCCAGGGACGTC-AACAAAAAGTC- 480


14222R-3.IR_full       481 GGTCATACCGTACACGCANCC 501
                           |||||||||||||||||| ||
14222R-3.in silico     481 GGTCATACCGTACACGCAGCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   479  NM_134487.2  CG14222-RA (CG14222), mRNA 
0   NM_132471.1  CG11105-RB, transcript variant B (CG11105), mRNA 
0   NM_167277.1  CG11105-RA, transcript variant A (CG11105), mRNA 
0   NM_140005.1  CG13309-RA (CG13309), mRNA 
0   NM_169375.1  CG31299-RB, transcript variant B (nocturnin), mRNA 
0   NM_169374.1  CG31299-RA, transcript variant A (nocturnin), mRNA 
0   NM_057897.3  CG14938-RB, transcript variant B (crol), mRNA 
0   NM_057895.3  CG14938-RA, transcript variant A (crol), mRNA 
0   NM_057896.3  CG14938-RC, transcript variant C (crol), mRNA 
0   NM_164971.1  CG14938-RD, transcript variant D (crol), mRNA 
0   NM_057921.3  CG7111-RA (Rack1), mRNA 
0   NM_143322.1  CG12883-RA (CG12883), mRNA 
0   NM_168647.1  CG32156-RA, transcript variant A (Mbs), mRNA 
0   NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 
0   NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0   NM_144056.2  CG15234-RA (CG15234), mRNA 
0   NM_057455.2  CG3827-RA (sc), mRNA 
0   NM_078605.1  CG6211-RA (gce), mRNA 
0   NM_001038863.1  CG33960-RA (CG33960), mRNA 
0   NM_169974.1  CG31335-RA (Gr93d), mRNA 
0   NM_138045.2  CG4057-RB, transcript variant B (tamo), mRNA 
0   NM_135832.2  CG16889-RA (adat), mRNA 
0   NM_166664.1  CG4057-RA, transcript variant A (tamo), mRNA 
0   NM_168552.1  CG32130-RC, transcript variant C (stv), mRNA 
0   NM_168554.1  CG32130-RD, transcript variant D (stv), mRNA 
0   NM_168553.1  CG32130-RB, transcript variant B (stv), mRNA 
0   NM_168551.1  CG32130-RA, transcript variant A (stv), mRNA 
0   NM_141661.1  CG8312-RA, transcript variant A (CG8312), mRNA 
0   NM_176438.1  CG8312-RB, transcript variant B (CG8312), mRNA 
0   12  NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.