National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14221Ra-1 
 Symbol CG14221  Full Name CG14221 
 CG No CG14221  Old CG No CG14221 
 Synonyms CG14221 
 Accession No (Link to NCBI) NM_134486.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCGCCTCGGATGAGGAGTTC 
 Primer Seq. 3'
aatctagaggtaccATCCCGATGTCCGGCAGGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCGCCTCGG ATGAGNAGTT CGAGAAGTTC CTGCAGCGAT CCGGATTGNT GGGTACGTTC 
0061 TCGATGCGAT GGTTAGCCAT TAGTCCACCC AGTAATCTCG CTCTAATCCC TGAGTGCTTC 
0121 AGTGCTCGAT ATATACTCCG AATGGTGCGG TCCCTGCCTC GGCATGGTGG GTAGCCTGCG 
0181 GAAGATCAAG CTCGAGCTAG GAGGCGACAA CCTGCAGTTG GCCATCTGCA AGGCGGGCTC 
0241 CATATCCTAT CTGAAGCGAT TCAACAAGAA GAGCGAGCCC ACGTGGATGT TTGTCACGAG 
0301 CGGCAAGGCC ATCAATATCA TGTTCGGCAC GGATGTGCCC AAGCTGGTGG CCATGATCAC 
0361 CCGAATGCTG CAGTCGACGA TGGCCAAGGA AACGCACCTG AGCTACGAGA TCACCGAGCT 
0421 CCAGCCGATC GAGCTGGAGC AGCTGGAGGT GCGCAACAAG GCTGCGCCTG GCCGAGGAGA 
0481 TCGAGCTGGC GGAGAGCGTC GGAAGCGGCT GGAGTACCTT CACAGCGTCA CCGACTGCAT 
0541 CATGGCCAAC TGCCGGACAT CG 
 in silico PCR Fragment
0001 CTCGCCTCGG ATGAGGAGTT CGAGAAGTTC CTGCAGCGAT CCGGATTGCT GGTGCTCGAT 
0061 ATATACTCCG AATGGTGCGG TCCCTGCCTC GGCATGGTGG GTAGCCTGCG GAAGATCAAG 
0121 CTCGAGCTAG GAGGCGACAA CCTGCAGTTG GCCATCTGCA AGGCGGGCTC CATATCCTAT 
0181 CTGAAGCGAT TCAACAAGAA GAGCGAGCCC ACGTGGATGT TTGTCACGAG CGGCAAGGCC 
0241 ATCAATATCA TGTTCGGCAC GGATGTGCCC AAGCTGGTGG CCATGATCAC CCGAATGCTG 
0301 CAGTCGACGA TGGCCAAGGA AACGCACCTG AGCTACGAGA TCACCGAGCT CCAGCCGATC 
0361 GAGCTGGAGC AGCTGGAGGT GCGCAACAAG GCGCTGCGCC TGGCCGAGGA GATCGAGCTG 
0421 GCGGAGAGCC GTCGGAAGCG GCTGGAGTAC CTTCACAGCG TCACCGACTG CATCATGGCC 
0481 AACCTGCCGG ACATCGGGAT  
 Assemble Data

14221Ra-1.IR full       1   CTCGCCTCGGATGAGNAGTTCGAGAAGTTCCTGCAGCGATCCGGATTGNTGGGTACGTTC 60
                            ||||||||||||||| |||||||||||||||||||||||||||||||| |||        
14221Ra-1.in silico     1   CTCGCCTCGGATGAGGAGTTCGAGAAGTTCCTGCAGCGATCCGGATTGCTGG-------- 60


14221Ra-1.IR full       61  TCGATGCGATGGTTAGCCATTAGTCCACCCAGTAATCTCGCTCTAATCCCTGAGTGCTTC 120
                                                                                        
14221Ra-1.in silico     61  ------------------------------------------------------------ 120


14221Ra-1.IR full       121 AGTGCTCGATATATACTCCGAATGGTGCGGTCCCTGCCTCGGCATGGTGGGTAGCCTGCG 180
                              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14221Ra-1.in silico     121 --TGCTCGATATATACTCCGAATGGTGCGGTCCCTGCCTCGGCATGGTGGGTAGCCTGCG 180


14221Ra-1.IR full       181 GAAGATCAAGCTCGAGCTAGGAGGCGACAACCTGCAGTTGGCCATCTGCAAGGCGGGCTC 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14221Ra-1.in silico     181 GAAGATCAAGCTCGAGCTAGGAGGCGACAACCTGCAGTTGGCCATCTGCAAGGCGGGCTC 240


14221Ra-1.IR full       241 CATATCCTATCTGAAGCGATTCAACAAGAAGAGCGAGCCCACGTGGATGTTTGTCACGAG 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14221Ra-1.in silico     241 CATATCCTATCTGAAGCGATTCAACAAGAAGAGCGAGCCCACGTGGATGTTTGTCACGAG 300


14221Ra-1.IR full       301 CGGCAAGGCCATCAATATCATGTTCGGCACGGATGTGCCCAAGCTGGTGGCCATGATCAC 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14221Ra-1.in silico     301 CGGCAAGGCCATCAATATCATGTTCGGCACGGATGTGCCCAAGCTGGTGGCCATGATCAC 360


14221Ra-1.IR full       361 CCGAATGCTGCAGTCGACGATGGCCAAGGAAACGCACCTGAGCTACGAGATCACCGAGCT 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14221Ra-1.in silico     361 CCGAATGCTGCAGTCGACGATGGCCAAGGAAACGCACCTGAGCTACGAGATCACCGAGCT 420


14221Ra-1.IR full       421 CCAGCCGATCGAGCTGGAGCAGCTGGAGGTGCGCAACAAGGC--TGCGCCTGGCCGAGGA 480
                            ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||
14221Ra-1.in silico     421 CCAGCCGATCGAGCTGGAGCAGCTGGAGGTGCGCAACAAGGCGCTGCGCCTGGCCGAGGA 480


14221Ra-1.IR full       481 GATCGAGCTGGCGGAGAGC-GTCGGAAGCGGCTGGAGTACCTTCACAGCGTCACCGACTG 540
                            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
14221Ra-1.in silico     481 GATCGAGCTGGCGGAGAGCCGTCGGAAGCGGCTGGAGTACCTTCACAGCGTCACCGACTG 540


14221Ra-1.IR full       541 CATCATGGCCAAC-TGCCGGACATCG---- 570
                            ||||||||||||| ||||||||||||    
14221Ra-1.in silico     541 CATCATGGCCAACCTGCCGGACATCGGGAT 570

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134486.1  CG14221-RA (CG14221), mRNA 
0.41   NM_079803.2  CG6127-RA (Ser), mRNA 
0.2   NM_143469.1  CG7837-RA (CG7837), mRNA 
0   15  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0   15  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0   NM_079716.2  CG6705-RA, transcript variant A (tsl), mRNA 
0   NM_169969.1  CG6705-RB, transcript variant B (tsl), mRNA 
0   NM_079633.2  CG6476-RA, transcript variant A (Su(var)3-9), mRNA 
0   NM_169874.1  CG4608-RA (bnl), mRNA 
0   10  33  NM_132544.1  CG18130-RA (CG18130), mRNA 
0   NM_136125.1  CG10034-RA (tj), mRNA 
0   28  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_206200.1  CG11206-RB, transcript variant B (CG11206), mRNA 
0   NM_137819.2  CG11206-RA, transcript variant A (CG11206), mRNA 
0   10  NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_137518.2  CG15073-RA (CG15073), mRNA 
0   NM_140310.1  CG4328-RA (CG4328), mRNA 
0   NM_058041.2  CG12467-RA (CG12467), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 
0   22  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   16  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_137506.2  CG5489-RA, transcript variant A (Atg7), mRNA 
0   NM_166298.1  CG5489-RB, transcript variant B (Atg7), mRNA 
0   NM_001043272.1  CG17299-RK, transcript variant K (SNF4Agamma), mRNA 
0   NM_001043273.1  CG17299-RJ, transcript variant J (SNF4Agamma), mRNA 
0   NM_169949.1  CG17299-RE, transcript variant E (SNF4Agamma), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.